ID: 1045897978

View in Genome Browser
Species Human (GRCh38)
Location 8:107241020-107241042
Sequence GCAAGGCGGCAGCGAGGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6328
Summary {0: 1061, 1: 2132, 2: 1737, 3: 742, 4: 656}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045897970_1045897978 30 Left 1045897970 8:107240967-107240989 CCGACGCCCACGTAGTCTCGCTG No data
Right 1045897978 8:107241020-107241042 GCAAGGCGGCAGCGAGGCTGGGG 0: 1061
1: 2132
2: 1737
3: 742
4: 656
1045897972_1045897978 23 Left 1045897972 8:107240974-107240996 CCACGTAGTCTCGCTGATTGCTA No data
Right 1045897978 8:107241020-107241042 GCAAGGCGGCAGCGAGGCTGGGG 0: 1061
1: 2132
2: 1737
3: 742
4: 656
1045897971_1045897978 24 Left 1045897971 8:107240973-107240995 CCCACGTAGTCTCGCTGATTGCT No data
Right 1045897978 8:107241020-107241042 GCAAGGCGGCAGCGAGGCTGGGG 0: 1061
1: 2132
2: 1737
3: 742
4: 656

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045897978 Original CRISPR GCAAGGCGGCAGCGAGGCTG GGG Intergenic
Too many off-targets to display for this crispr