ID: 1045901530

View in Genome Browser
Species Human (GRCh38)
Location 8:107287132-107287154
Sequence CTCAATGTGAATAAAGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045901525_1045901530 19 Left 1045901525 8:107287090-107287112 CCCTTTTCTGTGCAGTCATTGAA 0: 1
1: 0
2: 1
3: 29
4: 451
Right 1045901530 8:107287132-107287154 CTCAATGTGAATAAAGAGGCTGG No data
1045901526_1045901530 18 Left 1045901526 8:107287091-107287113 CCTTTTCTGTGCAGTCATTGAAA 0: 1
1: 0
2: 1
3: 27
4: 311
Right 1045901530 8:107287132-107287154 CTCAATGTGAATAAAGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045901530 Original CRISPR CTCAATGTGAATAAAGAGGC TGG Intronic
No off target data available for this crispr