ID: 1045906366

View in Genome Browser
Species Human (GRCh38)
Location 8:107350169-107350191
Sequence TTGCTGTCATTTAGGAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 280}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045906366 Original CRISPR TTGCTGTCATTTAGGAAACA TGG (reversed) Intronic
900855521 1:5178996-5179018 TTGCAGTCATTTTGGAAGCTTGG + Intergenic
901872813 1:12148068-12148090 TGGCTGTCATTTACTGAACATGG - Intergenic
903610408 1:24607463-24607485 TTGATGGCATCTTGGAAACAAGG + Exonic
904070640 1:27794029-27794051 TTGTTGTCGTTTTGGAGACAGGG + Intronic
905142176 1:35856168-35856190 ATGCTGTCATTTTGGACAAAAGG + Exonic
905608732 1:39329426-39329448 TAGCTGTCATTTAATAAATATGG - Intronic
905959249 1:42029911-42029933 TAGCTGACACTTTGGAAACAGGG - Intronic
908849641 1:68362855-68362877 TTGTTGTGTTTCAGGAAACAGGG + Intergenic
909600772 1:77458936-77458958 TTGCTGTCTTTTTCTAAACAGGG + Intronic
909904273 1:81176449-81176471 TTATTGTCATTTTGGAAACAAGG + Intergenic
910109143 1:83663443-83663465 TTATAGTCATTTTGGAAACAGGG - Intergenic
910269627 1:85379906-85379928 TTGCAATCATTCAGGCAACAGGG - Intronic
911717018 1:101144638-101144660 TTGCTTCCATTTAGTAAACATGG + Intergenic
911792686 1:102038585-102038607 ATGCTGTCATATTGGAAACTCGG + Intergenic
911895354 1:103426630-103426652 TTTCTGACTTTTAGGGAACAGGG + Intergenic
912348637 1:108990012-108990034 TTGTTGTCATTTAAAAAACTAGG + Intronic
913985935 1:143566216-143566238 TTCCTGCCCTTAAGGAAACAGGG + Intergenic
915089569 1:153415227-153415249 TTGCCGTCATATGGGAAACTGGG + Intergenic
917113233 1:171574381-171574403 TTTCTGCCATTTAAGAAACTAGG + Intronic
917644505 1:177017102-177017124 TTGCTGTCATTAGGAAAATAAGG - Intronic
919106993 1:193166172-193166194 TTTCTTTCTTTTTGGAAACAGGG + Intronic
919744893 1:201002485-201002507 TAGCTGTGTTTTAGGAAACCTGG - Intronic
920104891 1:203545389-203545411 TTGCTGTACTCTAGGACACAAGG + Intergenic
920309912 1:205043015-205043037 TTGCTGTCATTTAAGGACCAGGG - Intergenic
920763047 1:208804275-208804297 ATCCTGTCTTTTAGGTAACATGG - Intergenic
921271791 1:213476282-213476304 CCACTATCATTTAGGAAACAAGG - Intergenic
923247918 1:232151223-232151245 TTCCTGTCATTTGGGAAACCTGG - Intergenic
924194844 1:241595371-241595393 ATGCAGTCATTTAGGAATCTAGG - Exonic
1062997802 10:1883224-1883246 TTACTGTCATTTTTGAAACAGGG + Intergenic
1063315625 10:5002316-5002338 TTCTTATCAGTTAGGAAACAGGG + Intronic
1064343906 10:14513278-14513300 CTTCTTTCATTTAGGAAACTTGG - Intergenic
1064611638 10:17109428-17109450 CTGCTCTGATTTAGGAAATAAGG - Intronic
1064711808 10:18135206-18135228 ATGCTGACATTTAGGAACCGAGG - Intergenic
1065833990 10:29640622-29640644 TTGCGGTCAGGTAGGAAACCAGG - Intronic
1067026833 10:42849772-42849794 ATGCTGTCATTTAGGCAATGTGG + Intergenic
1067771666 10:49131103-49131125 ATGCTGTCATATTGGACACATGG - Intergenic
1068479036 10:57565280-57565302 ATTCTGTCATTTGTGAAACATGG - Intergenic
1068548501 10:58379902-58379924 TTGCTGTAATCCAGGAAAGAGGG - Intergenic
1069326969 10:67243042-67243064 TTGCTGTCATCTAAGAAAACAGG - Intronic
1069971037 10:72169474-72169496 TTGCTACCATTTAAGAAAGAAGG + Intronic
1070341110 10:75499251-75499273 TAGCTGTATTTTAGGAAGCAGGG - Intronic
1071106586 10:82104438-82104460 AAGCTGTCATTTAGGAAGCAGGG + Intronic
1073628815 10:105127201-105127223 TTGCTTTCCTGCAGGAAACAGGG - Intronic
1073913032 10:108368848-108368870 TTTTTTTCATTTAGGAGACAAGG - Intergenic
1074798193 10:116970883-116970905 TAGTTGTCTCTTAGGAAACAGGG + Intronic
1075080070 10:119377673-119377695 TTGCTGTCAGTATGGAAACAAGG - Intronic
1075437461 10:122455804-122455826 ATGCTGCCATTTAGGCAAAATGG - Intronic
1076215052 10:128686814-128686836 TTGCTGTCATTCCAGAAGCAAGG + Intergenic
1076946377 10:133654128-133654150 TTGCTTTCTTTTTGGATACAAGG + Intergenic
1079639034 11:22781147-22781169 CTGCTGTCCTTTGGCAAACAAGG + Intronic
1080272637 11:30467161-30467183 TTGCTGTCACTGAGGGCACAAGG + Intronic
1083084834 11:60131961-60131983 TTGCAGTGCTTTAGAAAACAAGG + Intergenic
1086352227 11:85953812-85953834 TTACTGTCTTATAGGAAACTTGG - Intergenic
1088757133 11:112894781-112894803 GTGCTGTTAAATAGGAAACAGGG - Intergenic
1092958746 12:13575650-13575672 TTGTTATCATTTTGGAGACAGGG - Intronic
1094034976 12:26059310-26059332 TTGGTGTCATTGAGAAGACAAGG + Intronic
1094801737 12:34045231-34045253 TAGCAGTCATTAAGGAAAGAAGG + Intergenic
1095114871 12:38341138-38341160 TAGCAGTCATTAAGGAAAGAAGG + Intergenic
1095243815 12:39894085-39894107 TTGCAAACATTTAGTAAACATGG + Intronic
1097363336 12:58682263-58682285 TTGATGTTATTGAGAAAACAAGG + Intronic
1097703192 12:62841061-62841083 ATTCTGCCATTTTGGAAACATGG - Intronic
1098052264 12:66467073-66467095 TACCAGTCAGTTAGGAAACATGG - Intronic
1098905678 12:76159804-76159826 TTGGTATCATTTAGGAAGAATGG - Intergenic
1099042151 12:77669074-77669096 TTTCCTTCATTTGGGAAACACGG - Intergenic
1099323596 12:81182291-81182313 ATGCTGTCCTTCAGGAAAGAAGG + Intronic
1099938057 12:89151671-89151693 TTGCTGTGCGTCAGGAAACAGGG - Intergenic
1100135762 12:91551549-91551571 TTGCAGTCATTTAAGAGAAAAGG + Intergenic
1100573442 12:95864892-95864914 TTCCTGTCTTTTAAGAAACAGGG - Intronic
1101778866 12:107817739-107817761 CTGCTGAGATTTGGGAAACAAGG - Intergenic
1103336746 12:120195304-120195326 TGGCTGCAATTTAGGGAACAGGG + Intergenic
1103690442 12:122768893-122768915 TTGATGTCATTCAGGAAAAATGG + Exonic
1106442088 13:29784493-29784515 TTGTTGCCATTTAGCAAAGAAGG - Intronic
1106619828 13:31362503-31362525 TTGCCTTCTTCTAGGAAACAGGG - Intergenic
1107014811 13:35699648-35699670 GTGTTGTCATTAAGGAAAAAGGG - Intergenic
1107344088 13:39440605-39440627 TTGCTGTCATTTTTGAGACAGGG + Intronic
1107372508 13:39768005-39768027 ATGCTGTCCATTAGGAACCAGGG + Intronic
1110035601 13:70678848-70678870 TTGATGCCAATTTGGAAACATGG + Intergenic
1110091998 13:71463532-71463554 TTGCTGTCACGTAGGAAGCAAGG + Intronic
1110114331 13:71793540-71793562 TTTCTTTCTTTTTGGAAACAGGG + Intronic
1110183975 13:72651329-72651351 GAGCTGTCAGTTAGGAATCACGG + Intergenic
1110451915 13:75646326-75646348 TTGCTGCTATTTTGGAAGCAAGG - Intronic
1112489430 13:99848520-99848542 TTGAAGGCATTTAGGTAACAGGG - Intronic
1113317968 13:109204230-109204252 GTTGTGTCATTTAGGAAACATGG + Intronic
1115332908 14:32217365-32217387 TTGCAGTCGTTCAGGAAACCAGG + Intergenic
1116419821 14:44720031-44720053 GGGCTGTCTTTTAGGAAAAAAGG - Intergenic
1116891180 14:50270301-50270323 ATGAAGTCATTTAGGAAATAGGG - Intronic
1117120445 14:52562584-52562606 TTGCTGTTTTTTAAGAGACAGGG - Intronic
1117359147 14:54956069-54956091 TTGTATTCATTTAGAAAACATGG - Intronic
1117481766 14:56152842-56152864 TTGATGTCAGTTAGAAAATATGG + Intronic
1118195322 14:63620269-63620291 ATCCTGTCATTTGTGAAACAGGG + Intronic
1120918100 14:89727844-89727866 TTTCTGTCATTTAAGACACATGG + Intergenic
1121165582 14:91793753-91793775 TTGTTGTGTCTTAGGAAACAGGG - Intronic
1124879793 15:33631417-33631439 TCAGTGTCATCTAGGAAACAGGG - Intronic
1127204875 15:56705162-56705184 TTGATGGCATTTAGGAAAATGGG - Intronic
1127481587 15:59382845-59382867 CTGATGCCATGTAGGAAACATGG + Intronic
1128286022 15:66437863-66437885 CTGCTCTCATTGAGGAAAGAAGG - Intronic
1128669026 15:69560484-69560506 TTGCTGTTATTTTTGAGACAGGG - Intergenic
1129889396 15:79061125-79061147 TAGCTGTCAGCAAGGAAACAGGG + Intronic
1130658541 15:85811173-85811195 TTGCTGTCTGTTGGGGAACAGGG - Intergenic
1131534063 15:93219637-93219659 TTGCTGTCATTTTACAGACAAGG + Intergenic
1132001920 15:98189107-98189129 TTACTGTCATTTTGGACAAATGG - Intergenic
1133588607 16:7220333-7220355 TTGGTGTCATTCATGCAACATGG + Intronic
1134781792 16:16904765-16904787 TTGCTGTGATGAAGGAAACCTGG + Intergenic
1139005525 16:62566636-62566658 TTGCTGTTATTTAGGGAACCAGG - Intergenic
1139203290 16:65001376-65001398 TTGCCTTCATTAAGGAAACTTGG - Intronic
1141103988 16:81218105-81218127 TTAATGTCATTTAAGAAGCAAGG - Intergenic
1141299441 16:82800062-82800084 TTCCTGTCTTTTAATAAACATGG - Intronic
1141309948 16:82903812-82903834 GTGCTCTTATTTACGAAACATGG - Intronic
1143726194 17:8848289-8848311 ATGCTGTCTTTTAGGAAAAGAGG - Intronic
1143748755 17:9013075-9013097 TTGCTGGCATTTAGTGGACAGGG + Intergenic
1146717797 17:35100927-35100949 GTGCTGTTGTTTGGGAAACAGGG - Exonic
1147520067 17:41162490-41162512 TTTCTGTAGTTTTGGAAACATGG - Intergenic
1148010003 17:44470843-44470865 TTGGTGTTTTTTAGGATACACGG - Intronic
1148223000 17:45877826-45877848 TTGCTGTCCCTTAGCAATCATGG + Intergenic
1149512396 17:57254892-57254914 TTACTGCAATTTAGGGAACAGGG + Intergenic
1152041246 17:77905269-77905291 TTTCTGTCATTTTGCAAAGAGGG + Intergenic
1153488066 18:5621391-5621413 TTACTATAATTCAGGAAACATGG + Intronic
1153719408 18:7886369-7886391 TAACTGTCATTTAAGAAAGAGGG - Intronic
1155121763 18:22827981-22828003 TTACTGTCAGTTGGGGAACAAGG - Intronic
1156263221 18:35463620-35463642 TTGCTATTACATAGGAAACATGG + Intronic
1156451986 18:37271927-37271949 TTCCTCTCATGTAGGAAGCAGGG + Intronic
1156891569 18:42196380-42196402 TTTCTTTAATTTAGAAAACAGGG + Intergenic
1158056170 18:53283855-53283877 CTGCTGTCTTTTATGAAGCAAGG - Intronic
1158928775 18:62299954-62299976 TCACTGACATTTATGAAACAAGG - Intronic
1159376595 18:67601379-67601401 TTGCTGTACCTTAGGCAACAGGG - Intergenic
1159643782 18:70893605-70893627 TTCCCTTCTTTTAGGAAACAAGG - Intergenic
1160545757 18:79652465-79652487 TTGCTCTCATTGTGGAAAGACGG - Intergenic
1161671027 19:5609747-5609769 TTACTGTGAGTCAGGAAACAAGG + Intronic
1161729736 19:5952003-5952025 TTTCTGTGCTTTAGGAAAGAGGG + Intronic
1163613641 19:18313522-18313544 TTGGTGTCTTTTATGAGACAGGG + Intronic
1163993108 19:21017853-21017875 TTGCTACCATTTTGCAAACACGG - Intergenic
925045806 2:772393-772415 TTGCTGTCCTTTGGGAAATGGGG - Intergenic
931408697 2:62006393-62006415 ATACTGTGATTTAGAAAACAAGG - Intronic
934559488 2:95305400-95305422 ATGCTGTCATTGGGGAAACCAGG - Intronic
935483432 2:103621996-103622018 TAGCTGTCCTTTAGGAATAATGG + Intergenic
938323234 2:130379805-130379827 TTTCCCTCATCTAGGAAACATGG - Intergenic
938648036 2:133351601-133351623 TGTGTGTCTTTTAGGAAACAAGG - Intronic
941198558 2:162480622-162480644 TTGGTGGCATTCAGAAAACATGG + Intronic
941509509 2:166388136-166388158 ATGTTGTCATTTATGAAAAATGG + Intergenic
941979979 2:171444729-171444751 TGGCTGTCCTTTAGGAAAAACGG + Intronic
944484190 2:200186537-200186559 TTGCTGTCATTTTGGATTAAGGG + Intergenic
945263666 2:207868940-207868962 TTGCTGTAAATAAGAAAACAGGG + Intronic
947477429 2:230463144-230463166 GTTCTCTCATCTAGGAAACAAGG - Intronic
948184219 2:236006986-236007008 TTACTGTCAATGAGTAAACAAGG - Intronic
1169305988 20:4490805-4490827 TTGCTGTGATAGAGGACACAGGG + Intergenic
1169310646 20:4536030-4536052 TTCCTGTCATTCAGGAAGGAGGG - Intergenic
1170383549 20:15789435-15789457 TTGCTGTCATATAAGAAAAATGG - Intronic
1170718190 20:18850389-18850411 TTTCTTTCTTTTAGGTAACAAGG + Intergenic
1171218595 20:23372889-23372911 TTGCTGTCGTTTGGAAAAAATGG + Exonic
1172907983 20:38383491-38383513 TTGCTTTTATTTTGGAAAGAAGG + Intergenic
1173038465 20:39435692-39435714 ATGCTATCATTGAGGAAACTGGG - Intergenic
1173689922 20:44952793-44952815 TTCTTGTAATATAGGAAACATGG - Intronic
1174978869 20:55368975-55368997 GTTCTGTCATTTAGGAAAACAGG - Intergenic
1175458074 20:59130172-59130194 TTGCTGTTATTAAAGAGACAGGG + Intergenic
1175695980 20:61102984-61103006 TTGCTGCCATTTTAAAAACAAGG + Intergenic
1176127115 20:63480565-63480587 ATGCTGACATTAAGAAAACATGG + Intergenic
1177240980 21:18456538-18456560 TTACTGGAATTTAGGAAACTAGG - Intronic
1177717834 21:24863098-24863120 TAGCTGTCTATGAGGAAACAGGG + Intergenic
1178809693 21:35870153-35870175 TTTCTTTCAGTTAGGAAATAAGG - Intronic
1179072240 21:38082611-38082633 TTGTTTTCATTTGGGACACATGG - Intronic
1182735362 22:32529225-32529247 TTGCTGTCATCCAGCAAACGTGG - Intronic
1184505243 22:44896839-44896861 TTTCTGTCACTTATGAAACAGGG + Intronic
949266091 3:2157870-2157892 TTGTTTTCATTTAAGAAACATGG + Intronic
949750066 3:7341911-7341933 CTGCTGTCATTCAGAAGACAAGG + Intronic
949781697 3:7696510-7696532 TTTCTGTTACTAAGGAAACATGG - Intronic
950793577 3:15493070-15493092 TAGCTGTCTTTTGGGAAAGAGGG + Intronic
952277355 3:31890320-31890342 CTGCTGTGATTTAGGAAAGCTGG - Intronic
953067245 3:39484913-39484935 TTGCTTTGTTTTAGGCAACAAGG - Intronic
953093063 3:39748831-39748853 TTGCTGGCTATTAAGAAACATGG - Intergenic
954286500 3:49623295-49623317 ATGCTGGCACTCAGGAAACAGGG - Intronic
957417009 3:79917940-79917962 TTGCTGTCATTAAGGTTACCAGG + Intergenic
959165311 3:102769625-102769647 TTGTTGTGTTTTAGGAAATATGG + Intergenic
959449784 3:106484887-106484909 TTGATGTGATTTATAAAACATGG + Intergenic
960257277 3:115524105-115524127 TTCCTCACATTTAGAAAACATGG - Intergenic
961032503 3:123618858-123618880 TTGCTATGATTTAGCAAAGAAGG + Intronic
961367903 3:126413072-126413094 TTGCCCTCAATTAGGAATCATGG - Intronic
961911024 3:130316718-130316740 CTGCTGTCATATAGAAAAGAAGG + Intergenic
962899149 3:139742668-139742690 TTGCTTTCTTTTAGGAAAAGCGG + Intergenic
963067543 3:141275292-141275314 TGGCTGCCATTTGGGAACCATGG - Intronic
964046483 3:152333963-152333985 CTGCTCCCATTTTGGAAACAAGG - Intronic
964068750 3:152606801-152606823 TTGTTGTAATTTGGGATACAAGG - Intergenic
964202453 3:154133319-154133341 GTGTTGTCATTTAGGAATAAAGG + Intronic
964700290 3:159558203-159558225 TAGCTGGTATTTAGGAACCATGG - Intronic
964938923 3:162130222-162130244 TTGCTTTCATTTAAGAGACCTGG + Intergenic
966342843 3:178944713-178944735 TTGTTGTCTTTAAGAAAACAAGG - Intergenic
967768749 3:193311419-193311441 TTGCTGTAATTTAAGAATCCAGG + Intronic
967845805 3:194041765-194041787 TTTCTGACATTCAGGAAAGAGGG - Intergenic
968390252 4:186957-186979 TTGCAGTCATTTGGAGAACATGG + Intergenic
970472263 4:16390702-16390724 ATGGTGTCATTTAGGTAACCTGG - Intergenic
972456045 4:39256477-39256499 TTGTTGTCATTTAGGAATCCAGG + Intronic
973270266 4:48255316-48255338 CTGCTGGCATTTAGGAAAGGGGG - Intronic
973933854 4:55821698-55821720 ATTCTGTCATGTAAGAAACAAGG + Intergenic
974297031 4:60013439-60013461 ATGCTGTTAATTAGGAAACCAGG + Intergenic
974595545 4:64011132-64011154 TTGCTTCCATGTAGGTAACAAGG + Intergenic
975070182 4:70125799-70125821 TATCTGCCATTTAGGAAATAAGG + Intergenic
976033686 4:80790248-80790270 CTGCTGTGAGCTAGGAAACATGG - Intronic
977465451 4:97378638-97378660 TTGTTGTCAGTTAAGAAAAAAGG - Intronic
978094582 4:104760608-104760630 TTACTGTCATTTTTGAAACTTGG + Intergenic
979302703 4:119105816-119105838 TTCCTGTCATTCAGGAAGAAGGG + Intergenic
979896130 4:126159726-126159748 TTGATGTCATTCAAGATACAAGG - Intergenic
979902403 4:126238825-126238847 TTGCAGTAATTTAGTAAATATGG - Intergenic
980297944 4:130947011-130947033 TGGCTGTCATGGAAGAAACATGG - Intergenic
981449227 4:144876827-144876849 TTGCTGATATTTAAAAAACAAGG + Intergenic
981612617 4:146611426-146611448 TAGCTGTCATTTTAGAAAAAAGG + Intergenic
982775359 4:159436012-159436034 TTGGTGTCATTTAGAATACTGGG - Intergenic
984247171 4:177289000-177289022 TGACTGACAATTAGGAAACATGG - Intergenic
984395760 4:179197523-179197545 TTGTTGTTATTAAGAAAACAAGG + Intergenic
984445965 4:179836253-179836275 TAGATGTCATTTTGGAAAGAAGG - Intergenic
984772804 4:183452671-183452693 TTTCTGGAATATAGGAAACAAGG - Intergenic
985345473 4:189000615-189000637 TTGCGGTCATTTGGAAAAAAGGG + Intergenic
987136100 5:14900961-14900983 TTGCTGTCTTATAGGAAGCTAGG + Intergenic
988136580 5:27179472-27179494 TTGCTGTCATTCAGCAATGAAGG - Intergenic
990210190 5:53474924-53474946 TTGCTGACATTAAGGCACCAAGG + Intergenic
990508880 5:56471918-56471940 ATGCAGTCATTTAGGAATCCAGG + Intronic
991425509 5:66487893-66487915 TTGCTGGCATTCAAGAAGCAAGG - Intergenic
991431280 5:66550071-66550093 GTCCTGTCATTTAAGATACAAGG + Intergenic
992090890 5:73315871-73315893 TTGTTGTTGTTTTGGAAACAGGG + Intergenic
992226976 5:74628347-74628369 TTGCTGTATTTTAGAAAATAGGG - Exonic
992996686 5:82340749-82340771 TTCCTGTCATTGAGGAAAACAGG + Intronic
994382577 5:99088759-99088781 TTGCAGTCATTTTGGAAAATGGG - Intergenic
994489760 5:100425926-100425948 ATTTTGTCTTTTAGGAAACATGG + Intergenic
994872762 5:105374694-105374716 TTTCTGGCATTTAGGACACAAGG - Intergenic
994970185 5:106727694-106727716 TGCGTGTCATTTATGAAACAGGG - Intergenic
996764231 5:127019687-127019709 GTGATGTCATCAAGGAAACAGGG - Intronic
996794347 5:127328091-127328113 TTTCTCTAAATTAGGAAACATGG - Intronic
997129209 5:131260270-131260292 TTTCTAACATTTAGGAGACATGG - Intronic
998558029 5:143144716-143144738 TTGGAGTCAATTAGGAAATAAGG - Intronic
1000475380 5:161700303-161700325 TTGCTGCCAGCAAGGAAACAAGG + Intronic
1000691976 5:164335048-164335070 TTACTGTCATTTCAGAAAGATGG - Intergenic
1000873996 5:166612988-166613010 CTGCTGGCATTGAGGAAGCAAGG - Intergenic
1001717009 5:173824536-173824558 TTGCCTTCTTTTAGGGAACAGGG + Intergenic
1001768396 5:174273229-174273251 TTAATGTCATTTTGGAGACAAGG + Intergenic
1003826658 6:9960240-9960262 CAGCTGTCAGTTAGGAAACCAGG + Intronic
1005480055 6:26247162-26247184 TTGCTGGCATTTAGAGAATAAGG + Intergenic
1008660431 6:53662207-53662229 CTGCTGTCATTTAGGAAAAATGG - Intronic
1009738449 6:67710376-67710398 TTTGTGTCATTTTGGAATCAAGG + Intergenic
1010218190 6:73423818-73423840 TTGGTGTCTTTTAGTAAACAAGG - Exonic
1012350074 6:98239509-98239531 ATGGTGTCATTTAAGCAACATGG - Intergenic
1013535592 6:111060504-111060526 TTGTTGTTTTTTAGGAAACAGGG - Intergenic
1014489798 6:122047811-122047833 TTGCTGTCATTTCGGAAATATGG - Intergenic
1014698964 6:124659629-124659651 TCACTGTCAGTAAGGAAACAAGG + Intronic
1014758192 6:125325308-125325330 TTGCTGTCATTTTGTGTACAAGG + Intergenic
1015258693 6:131209927-131209949 TAGCTGTCACTTACTAAACAAGG - Intronic
1015266117 6:131293852-131293874 TAGCTGTCTGTTTGGAAACAAGG - Intergenic
1016320716 6:142842653-142842675 TTGCAGTCTTTCAGGAAACAAGG - Intronic
1017696281 6:157019597-157019619 TTGCTTTCATTAAGGAAGGAGGG + Intronic
1017702909 6:157093261-157093283 TTATTCTCTTTTAGGAAACATGG - Intronic
1019038787 6:169085291-169085313 GTGCTGTCATTTTGGAGTCAGGG - Intergenic
1020481145 7:8663144-8663166 TTGGAGTCATTTAGTATACATGG + Intronic
1020755538 7:12197888-12197910 TTGCTTTTTTTTTGGAAACAGGG + Intergenic
1021785213 7:24144371-24144393 TTGCTGGCTTCGAGGAAACAAGG + Intergenic
1022121655 7:27314360-27314382 TAGCTCTCATACAGGAAACAAGG - Intergenic
1022821971 7:33970904-33970926 TTGCTGTCAGCTAGGAAGCAGGG - Intronic
1022834621 7:34101916-34101938 TTGCAGCCAAATAGGAAACAAGG - Intronic
1022889407 7:34681315-34681337 TTCCTGTCATTTTGGGCACAGGG + Intronic
1023339313 7:39202766-39202788 TTGCTGTCATTTAATAACAAGGG - Intronic
1024088071 7:45913334-45913356 GTGGTGTCATTTCTGAAACAAGG - Intronic
1028047334 7:86139144-86139166 TTCCTATCATTTATGTAACATGG + Intergenic
1028194100 7:87885304-87885326 TTGCTGTCTTTTAGGAAGGTGGG + Intronic
1028454594 7:91025002-91025024 TTGAAGTAATTTAGGAATCAAGG + Intronic
1028646128 7:93098679-93098701 CTGCTGGCATTGAGGAAATAAGG + Intergenic
1029031235 7:97469343-97469365 TTGCTGCCATGTATGTAACATGG + Intergenic
1031152655 7:118072736-118072758 TTGGTGACATTTATGAAAAAGGG - Intergenic
1031249366 7:119359650-119359672 TTCATGGCATTTAGGAAAAATGG + Intergenic
1031811586 7:126376093-126376115 TTGCTAACATTTATGTAACATGG - Intergenic
1033204651 7:139408051-139408073 TGGCTGACAGATAGGAAACATGG + Intronic
1035831571 8:2700234-2700256 TTCCTCTGATTTAGCAAACACGG + Intergenic
1035925529 8:3723787-3723809 TTGCGGTCATTTTGAAATCATGG - Intronic
1038769600 8:30465171-30465193 ATGCTGTCAAATAAGAAACATGG - Intronic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1040846583 8:51848408-51848430 ATTCTGTCTTATAGGAAACATGG - Intronic
1042935786 8:74056743-74056765 TGGCAGTCAGTGAGGAAACAGGG + Intergenic
1043467703 8:80528739-80528761 TTTCTTTCATCTAGGAACCAGGG - Intergenic
1044303531 8:90611849-90611871 TTGGAGTCTTTTAGGGAACAGGG - Intergenic
1044406676 8:91835138-91835160 TTGCTATCTTTTAGCAAACTAGG + Intergenic
1045328078 8:101131721-101131743 TTGCTTTCCTTTGGAAAACAAGG - Intergenic
1045435904 8:102163607-102163629 TTGATGTGATTTAGGGCACAGGG - Intergenic
1045466806 8:102477571-102477593 TTGTTGTCATTTTTGAGACAGGG - Intergenic
1045906366 8:107350169-107350191 TTGCTGTCATTTAGGAAACATGG - Intronic
1046333615 8:112754535-112754557 CTTTTGTCATTTAGGCAACAAGG + Intronic
1046967797 8:120186628-120186650 TTACAGTTATTTAGGAATCAGGG - Intronic
1047790784 8:128201462-128201484 TTGCTTTCATTTTGGAAATAAGG + Intergenic
1048267457 8:133000043-133000065 TTGCTGTCACTTGTAAAACAGGG - Intronic
1048541217 8:135343836-135343858 TTACTGTCATCTAGTAAACAGGG - Intergenic
1049153863 8:141055402-141055424 CTGCTGCCAATTAGGAAGCAAGG - Intergenic
1050851981 9:10299919-10299941 TTGCTCTCATATAGAAAACTTGG + Intronic
1051210939 9:14742572-14742594 TTGCTGTCCTTGTGGAAATATGG + Intronic
1051973092 9:22914297-22914319 TGGCTGGCTTTTAGGAAAAAGGG - Intergenic
1052832445 9:33227562-33227584 TTGTTGTCATTTTTGAGACAGGG + Intronic
1055261667 9:74443727-74443749 TTACTGTCATCTAGGAGACCTGG + Intergenic
1056592004 9:87971426-87971448 TTACTGTCTTTTTGGATACAGGG - Intronic
1057604038 9:96485923-96485945 TAGGTGTCATTTAAGATACAGGG + Intronic
1058904171 9:109468105-109468127 TTGCTGTAGTACAGGAAACAGGG - Intronic
1059461585 9:114434223-114434245 CTGCTGTCATCTATGAAACACGG - Intronic
1059904591 9:118968562-118968584 TTGCTGTAATTTAGGTTACAAGG + Intergenic
1185948986 X:4409572-4409594 TTGCTGTTTTTTAGTAAACCAGG - Intergenic
1186235030 X:7498501-7498523 CTGCTCTCATTTTGGAAAGAAGG + Intergenic
1186952167 X:14638576-14638598 TTACTTTCATCTAGGAGACATGG - Intronic
1187083846 X:16021382-16021404 TTGTGGTCATTTAGGAACCCAGG + Intergenic
1187617486 X:21013394-21013416 TTGCTATCATTTAGTAAGCAGGG + Intergenic
1188633926 X:32404544-32404566 TTGCAGTAATTTAAGCAACAGGG + Intronic
1188709595 X:33379059-33379081 TTGCTCTCAGTTGAGAAACACGG - Intergenic
1189260859 X:39678010-39678032 TTGCTCTGGTTTAGGAAAGATGG - Intergenic
1192053527 X:67748348-67748370 TTGCCCTCCCTTAGGAAACAAGG + Intergenic
1193709751 X:84864597-84864619 TTGCAGTAATTTACAAAACAAGG - Intergenic
1194051857 X:89079146-89079168 TTTCTGCCATCTAGGAAACAAGG - Intergenic
1194818977 X:98482418-98482440 TTGCTGACATTTTCCAAACATGG - Intergenic
1196103155 X:111868596-111868618 CTGATTTCTTTTAGGAAACATGG - Intronic
1197172286 X:123447721-123447743 TTGCTGTCATACAGTAACCAGGG - Intronic
1197264118 X:124347814-124347836 TTGATTTCTTTTAGGAATCATGG + Intronic
1197582990 X:128309043-128309065 TTGCTGTCATTTATGAAGTGAGG - Intergenic
1197951501 X:131902370-131902392 TTGCTACCATTTTGAAAACATGG + Intergenic
1198692053 X:139295120-139295142 TTGCTGTCATTTCAGCACCAAGG + Intergenic