ID: 1045906855

View in Genome Browser
Species Human (GRCh38)
Location 8:107355944-107355966
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045906848_1045906855 20 Left 1045906848 8:107355901-107355923 CCTTAAGCACAAGCACTACCTGG 0: 1
1: 0
2: 1
3: 11
4: 122
Right 1045906855 8:107355944-107355966 TTTCACTGCCTGGCACATAGTGG No data
1045906851_1045906855 2 Left 1045906851 8:107355919-107355941 CCTGGTTCAACTTGGTACCACTT 0: 1
1: 0
2: 0
3: 3
4: 78
Right 1045906855 8:107355944-107355966 TTTCACTGCCTGGCACATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr