ID: 1045909880

View in Genome Browser
Species Human (GRCh38)
Location 8:107394523-107394545
Sequence CAGAATAAGGAGCTGGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045909870_1045909880 30 Left 1045909870 8:107394470-107394492 CCTACAGATTTAATGTTATCAGA 0: 1
1: 0
2: 0
3: 7
4: 191
Right 1045909880 8:107394523-107394545 CAGAATAAGGAGCTGGGGGGAGG No data
1045909872_1045909880 1 Left 1045909872 8:107394499-107394521 CCCAGAGGAGTTAGTTTTCAGAG 0: 1
1: 0
2: 0
3: 13
4: 170
Right 1045909880 8:107394523-107394545 CAGAATAAGGAGCTGGGGGGAGG No data
1045909873_1045909880 0 Left 1045909873 8:107394500-107394522 CCAGAGGAGTTAGTTTTCAGAGT 0: 1
1: 0
2: 0
3: 16
4: 156
Right 1045909880 8:107394523-107394545 CAGAATAAGGAGCTGGGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045909880 Original CRISPR CAGAATAAGGAGCTGGGGGG AGG Intronic
No off target data available for this crispr