ID: 1045911977

View in Genome Browser
Species Human (GRCh38)
Location 8:107420693-107420715
Sequence CAGCATTCATATATGGTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045911974_1045911977 10 Left 1045911974 8:107420660-107420682 CCAAAACTTTTGTTATCAATCTG 0: 1
1: 0
2: 1
3: 19
4: 231
Right 1045911977 8:107420693-107420715 CAGCATTCATATATGGTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045911977 Original CRISPR CAGCATTCATATATGGTCCA TGG Intronic
No off target data available for this crispr