ID: 1045924784

View in Genome Browser
Species Human (GRCh38)
Location 8:107571334-107571356
Sequence TAGGAAGAACATCACGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045924784_1045924793 -4 Left 1045924784 8:107571334-107571356 CCCACCCCGTGATGTTCTTCCTA No data
Right 1045924793 8:107571353-107571375 CCTAACATTTATGGGGAAAGAGG No data
1045924784_1045924794 20 Left 1045924784 8:107571334-107571356 CCCACCCCGTGATGTTCTTCCTA No data
Right 1045924794 8:107571377-107571399 TGATATTACTTTCAGTATCCAGG No data
1045924784_1045924796 22 Left 1045924784 8:107571334-107571356 CCCACCCCGTGATGTTCTTCCTA No data
Right 1045924796 8:107571379-107571401 ATATTACTTTCAGTATCCAGGGG No data
1045924784_1045924795 21 Left 1045924784 8:107571334-107571356 CCCACCCCGTGATGTTCTTCCTA No data
Right 1045924795 8:107571378-107571400 GATATTACTTTCAGTATCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045924784 Original CRISPR TAGGAAGAACATCACGGGGT GGG (reversed) Intergenic
No off target data available for this crispr