ID: 1045924795

View in Genome Browser
Species Human (GRCh38)
Location 8:107571378-107571400
Sequence GATATTACTTTCAGTATCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045924786_1045924795 17 Left 1045924786 8:107571338-107571360 CCCCGTGATGTTCTTCCTAACAT No data
Right 1045924795 8:107571378-107571400 GATATTACTTTCAGTATCCAGGG No data
1045924787_1045924795 16 Left 1045924787 8:107571339-107571361 CCCGTGATGTTCTTCCTAACATT No data
Right 1045924795 8:107571378-107571400 GATATTACTTTCAGTATCCAGGG No data
1045924785_1045924795 20 Left 1045924785 8:107571335-107571357 CCACCCCGTGATGTTCTTCCTAA No data
Right 1045924795 8:107571378-107571400 GATATTACTTTCAGTATCCAGGG No data
1045924784_1045924795 21 Left 1045924784 8:107571334-107571356 CCCACCCCGTGATGTTCTTCCTA No data
Right 1045924795 8:107571378-107571400 GATATTACTTTCAGTATCCAGGG No data
1045924788_1045924795 15 Left 1045924788 8:107571340-107571362 CCGTGATGTTCTTCCTAACATTT No data
Right 1045924795 8:107571378-107571400 GATATTACTTTCAGTATCCAGGG No data
1045924792_1045924795 2 Left 1045924792 8:107571353-107571375 CCTAACATTTATGGGGAAAGAGG No data
Right 1045924795 8:107571378-107571400 GATATTACTTTCAGTATCCAGGG No data
1045924783_1045924795 22 Left 1045924783 8:107571333-107571355 CCCCACCCCGTGATGTTCTTCCT No data
Right 1045924795 8:107571378-107571400 GATATTACTTTCAGTATCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045924795 Original CRISPR GATATTACTTTCAGTATCCA GGG Intergenic
No off target data available for this crispr