ID: 1045932760 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:107646446-107646468 |
| Sequence | GTGCCCACCCGGACTGAGGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1045932753_1045932760 | 29 | Left | 1045932753 | 8:107646394-107646416 | CCACGTTCTTCTACCTGCTTTTA | No data | ||
| Right | 1045932760 | 8:107646446-107646468 | GTGCCCACCCGGACTGAGGATGG | No data | ||||
| 1045932754_1045932760 | 16 | Left | 1045932754 | 8:107646407-107646429 | CCTGCTTTTATTCTAGTCCTGCT | No data | ||
| Right | 1045932760 | 8:107646446-107646468 | GTGCCCACCCGGACTGAGGATGG | No data | ||||
| 1045932756_1045932760 | -1 | Left | 1045932756 | 8:107646424-107646446 | CCTGCTGGCAGCTGCTTAGATGG | No data | ||
| Right | 1045932760 | 8:107646446-107646468 | GTGCCCACCCGGACTGAGGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1045932760 | Original CRISPR | GTGCCCACCCGGACTGAGGA TGG | Intergenic | ||
| No off target data available for this crispr | |||||