ID: 1045932760

View in Genome Browser
Species Human (GRCh38)
Location 8:107646446-107646468
Sequence GTGCCCACCCGGACTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045932753_1045932760 29 Left 1045932753 8:107646394-107646416 CCACGTTCTTCTACCTGCTTTTA No data
Right 1045932760 8:107646446-107646468 GTGCCCACCCGGACTGAGGATGG No data
1045932754_1045932760 16 Left 1045932754 8:107646407-107646429 CCTGCTTTTATTCTAGTCCTGCT No data
Right 1045932760 8:107646446-107646468 GTGCCCACCCGGACTGAGGATGG No data
1045932756_1045932760 -1 Left 1045932756 8:107646424-107646446 CCTGCTGGCAGCTGCTTAGATGG No data
Right 1045932760 8:107646446-107646468 GTGCCCACCCGGACTGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045932760 Original CRISPR GTGCCCACCCGGACTGAGGA TGG Intergenic
No off target data available for this crispr