ID: 1045933957

View in Genome Browser
Species Human (GRCh38)
Location 8:107657632-107657654
Sequence CTGATATTCCTACTGGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045933957_1045933962 19 Left 1045933957 8:107657632-107657654 CCTGCACCCAGTAGGAATATCAG No data
Right 1045933962 8:107657674-107657696 CATACTACCTCTCTAAAGCCAGG No data
1045933957_1045933963 20 Left 1045933957 8:107657632-107657654 CCTGCACCCAGTAGGAATATCAG No data
Right 1045933963 8:107657675-107657697 ATACTACCTCTCTAAAGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045933957 Original CRISPR CTGATATTCCTACTGGGTGC AGG (reversed) Intergenic
No off target data available for this crispr