ID: 1045946536

View in Genome Browser
Species Human (GRCh38)
Location 8:107802622-107802644
Sequence CCTTCCCTATTCAAGGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045946536_1045946541 29 Left 1045946536 8:107802622-107802644 CCATGTCCCTTGAATAGGGAAGG No data
Right 1045946541 8:107802674-107802696 GTTCCTTCCAGGTTTCTGATTGG No data
1045946536_1045946540 18 Left 1045946536 8:107802622-107802644 CCATGTCCCTTGAATAGGGAAGG No data
Right 1045946540 8:107802663-107802685 AAAAATTCAGCGTTCCTTCCAGG No data
1045946536_1045946542 30 Left 1045946536 8:107802622-107802644 CCATGTCCCTTGAATAGGGAAGG No data
Right 1045946542 8:107802675-107802697 TTCCTTCCAGGTTTCTGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045946536 Original CRISPR CCTTCCCTATTCAAGGGACA TGG (reversed) Intergenic
No off target data available for this crispr