ID: 1045949997

View in Genome Browser
Species Human (GRCh38)
Location 8:107840730-107840752
Sequence TTGTGTGGGCACATAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045949997_1045950003 4 Left 1045949997 8:107840730-107840752 CCCTCCACTATGTGCCCACACAA No data
Right 1045950003 8:107840757-107840779 AAGGCAGTCATCTGCACACTAGG No data
1045949997_1045950004 22 Left 1045949997 8:107840730-107840752 CCCTCCACTATGTGCCCACACAA No data
Right 1045950004 8:107840775-107840797 CTAGGAAGAGAGCCCTCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045949997 Original CRISPR TTGTGTGGGCACATAGTGGA GGG (reversed) Intergenic
No off target data available for this crispr