ID: 1045951422

View in Genome Browser
Species Human (GRCh38)
Location 8:107855682-107855704
Sequence GTACCAGCTTAATATAGTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045951421_1045951422 1 Left 1045951421 8:107855658-107855680 CCAAAGGTGCTAATGTCTGTGCT No data
Right 1045951422 8:107855682-107855704 GTACCAGCTTAATATAGTAGTGG No data
1045951420_1045951422 13 Left 1045951420 8:107855646-107855668 CCAGTGCTCACACCAAAGGTGCT No data
Right 1045951422 8:107855682-107855704 GTACCAGCTTAATATAGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045951422 Original CRISPR GTACCAGCTTAATATAGTAG TGG Intergenic
No off target data available for this crispr