ID: 1045956021

View in Genome Browser
Species Human (GRCh38)
Location 8:107909031-107909053
Sequence CAGCCAACTCATTGTGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 131}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045956021_1045956026 -8 Left 1045956021 8:107909031-107909053 CCAGCACCACAATGAGTTGGCTG 0: 1
1: 0
2: 0
3: 21
4: 131
Right 1045956026 8:107909046-107909068 GTTGGCTGCACTGGTGAGGGTGG No data
1045956021_1045956028 25 Left 1045956021 8:107909031-107909053 CCAGCACCACAATGAGTTGGCTG 0: 1
1: 0
2: 0
3: 21
4: 131
Right 1045956028 8:107909079-107909101 AATATACTAGGCAATTTGCTAGG No data
1045956021_1045956027 13 Left 1045956021 8:107909031-107909053 CCAGCACCACAATGAGTTGGCTG 0: 1
1: 0
2: 0
3: 21
4: 131
Right 1045956027 8:107909067-107909089 GGAAAGACAGCAAATATACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045956021 Original CRISPR CAGCCAACTCATTGTGGTGC TGG (reversed) Intronic
902695739 1:18139636-18139658 CACCCAACACGTTGTGGGGCTGG - Intronic
903744550 1:25577736-25577758 GAGCCAACTCACGGTGATGCCGG - Intergenic
905371225 1:37483593-37483615 CAGCTTACTCACTGGGGTGCTGG - Exonic
907226696 1:52954013-52954035 CAGCAAAACCTTTGTGGTGCCGG + Intronic
907707986 1:56849248-56849270 CAGACATCTCAGTGTGGTGCTGG + Intergenic
908968879 1:69800839-69800861 CTCCCAATTCATTGTGGTGTTGG + Intronic
912529651 1:110311045-110311067 CAGCCAGTACATGGTGGTGCTGG + Intergenic
912824714 1:112894910-112894932 CAGCCACCTCCTTGTGGGGCAGG + Intergenic
918962831 1:191302808-191302830 CAGGGAACTCACTCTGGTGCGGG + Intergenic
922538086 1:226397782-226397804 CAGTCAACACAGTGTGGTACTGG + Intronic
924331848 1:242947291-242947313 CAGCCATCTCAGCGTGGTTCAGG - Intergenic
924692432 1:246363980-246364002 CAGAGAAGTCAATGTGGTGCTGG + Intronic
1063541270 10:6936680-6936702 CAGGCAGCTCATTCTGGTGAGGG - Intergenic
1066263050 10:33747790-33747812 CAACAAACTCTTTGTGGTGGTGG + Intergenic
1075809630 10:125215574-125215596 CTGCCAAGTCAGGGTGGTGCAGG - Intergenic
1077592510 11:3503533-3503555 CAGCCAACCCATTGTGGACATGG + Intergenic
1079260285 11:18871979-18872001 CAGCGAGATCATGGTGGTGCTGG - Intergenic
1080070136 11:28073141-28073163 CAGTCCATTCATTGTGGTTCTGG + Intronic
1081237057 11:40658971-40658993 CTGCCAACTCATTAGGGTGCAGG - Intronic
1084248345 11:67876256-67876278 CAGCCAACCCATTGTGGACATGG + Intergenic
1084366746 11:68706424-68706446 CAGGGAACTCAGTGTGGGGCTGG - Intergenic
1084824476 11:71719225-71719247 CAGCCAACCCATTGTGGACATGG - Intergenic
1084968403 11:72756270-72756292 CACCCAACACAATGAGGTGCCGG + Intronic
1086305281 11:85472879-85472901 CTGCCAATTCACTGTGCTGCTGG + Intronic
1090634786 11:128684160-128684182 AAGCCAACTCAGAGTGGTGCAGG + Intergenic
1090803526 11:130188904-130188926 CAGCCGACTCCTTGTGGTAGGGG - Exonic
1091021052 11:132100359-132100381 CAGTCAGATCATAGTGGTGCTGG - Intronic
1092172491 12:6382871-6382893 CTGCCAACTCCTTGTGGCTCAGG - Intronic
1093057570 12:14569985-14570007 CAGACAACTCTTTGTTGTGGGGG + Intergenic
1099564814 12:84230069-84230091 CAGCACACTCATAGTGGTGGTGG - Intergenic
1101092785 12:101304720-101304742 CAGAGAACTCTTTGTGGTGGAGG - Intronic
1103713561 12:122930072-122930094 CGCGCACCTCATTGTGGTGCTGG - Exonic
1104198772 12:126567261-126567283 CAGCCACCTCCCTGTGGGGCAGG + Intergenic
1105812333 13:24006716-24006738 CAGCCTACACATGGTGGAGCTGG + Intronic
1106657580 13:31762821-31762843 AAGACAACTCATTGTGGCTCAGG - Intronic
1114473209 14:22977875-22977897 CAGCCACCTCACTGGAGTGCAGG - Intronic
1115421331 14:33198872-33198894 CAGCCACCTCCCTGTGGGGCAGG - Intronic
1118434829 14:65761007-65761029 CAGCCAAAACATCATGGTGCTGG - Intergenic
1119917678 14:78417361-78417383 TGGCCAACTCCTTCTGGTGCTGG + Intronic
1125888814 15:43250415-43250437 CAGCCAATTAATGGTAGTGCTGG + Intronic
1126107289 15:45155008-45155030 CAGCCAACAAAGAGTGGTGCAGG + Intronic
1127381464 15:58434173-58434195 CAGACAATTCATTGTTGTGAGGG - Intronic
1131675700 15:94668075-94668097 AAGGCAACTCATTGCGGTCCAGG - Intergenic
1133358064 16:5151505-5151527 CAGCCAACCCATTGTGGACATGG + Intergenic
1138247077 16:55475702-55475724 CAGGCAACTCCTTGGGTTGCAGG + Intronic
1138873821 16:60925793-60925815 CAGCCAGCACAGTGTGGTGGAGG - Intergenic
1149997842 17:61414155-61414177 CAGTCAACAAATTGTAGTGCTGG - Intergenic
1150439059 17:65177013-65177035 CATCCATCTCACTATGGTGCTGG + Intronic
1150439079 17:65177110-65177132 CATCCATCTCACTATGGTGCTGG + Intronic
1151744115 17:76002328-76002350 CACCCAACTCATTGATGAGCAGG - Exonic
1151963005 17:77417130-77417152 GAGCCATCTCATTGAGTTGCTGG + Intronic
1153787269 18:8545998-8546020 CAGGCAACTCATTCAGGGGCTGG + Intergenic
1154176898 18:12091896-12091918 CAGCCAGCTCATAGCTGTGCAGG + Intergenic
1154511545 18:15109232-15109254 CATTCAACTCATTGGGGTGTGGG + Intergenic
1155309699 18:24511335-24511357 AAGTCAACACATTGAGGTGCGGG + Intergenic
1157563873 18:48666781-48666803 CAGCCCACTCATTCAGTTGCAGG + Intronic
927879378 2:26679910-26679932 CACCCAACTCATTGTGGGGTGGG - Intergenic
933264989 2:80172160-80172182 TAGCCAAATCATTTTAGTGCAGG - Intronic
936773177 2:115939414-115939436 CAGCCAACACATTTAGGTTCTGG - Intergenic
937026691 2:118704615-118704637 CAGCAAATTCATGGTTGTGCTGG + Intergenic
938511117 2:131945950-131945972 CATTCAACTCATTGGGGTGTGGG + Intergenic
941302929 2:163827249-163827271 CAGCCTAGTCATAGTGGTGGTGG - Intergenic
948929008 2:241118925-241118947 CAGCTTACTCACTGGGGTGCTGG - Intronic
1170748356 20:19121063-19121085 CAGCCAACTTGATGTGGAGCTGG + Intergenic
1172413813 20:34747421-34747443 CAGCAAAATCTTTGTGGTGGTGG - Intronic
1172463157 20:35135277-35135299 CAGGTAACTTATTGTGATGCAGG + Intronic
1173241297 20:41300005-41300027 TACCCAACTCATTGTGGTGAAGG - Exonic
1175354960 20:58357814-58357836 CAGACAACTCAAAGTGGTGGAGG + Intronic
1177980351 21:27905972-27905994 CATTCAACTCATTGGGGTGTGGG - Intergenic
1178885674 21:36483149-36483171 CTGCCAACTCATTCTGGAGGTGG - Intronic
1185350073 22:50330779-50330801 CAGAGAAGTCAATGTGGTGCTGG + Intergenic
949316380 3:2760560-2760582 CAGTCAACACAGTGTGGTACTGG - Intronic
950678819 3:14570956-14570978 CAGACAATTCTTTGTGGTGGCGG + Intergenic
953026205 3:39146671-39146693 CAGCCCAGTCATGGTGGTGCCGG + Exonic
953540629 3:43814593-43814615 CAGGCAACTCTGTGTGGTGCAGG - Intergenic
954189438 3:48946734-48946756 CGTCTAACCCATTGTGGTGCAGG + Intronic
955349365 3:58182658-58182680 CAACCCAATCATTGAGGTGCCGG + Intergenic
956894965 3:73650109-73650131 CAGCCAGATAATTGGGGTGCTGG + Intergenic
957062583 3:75494100-75494122 CAGCCAACCCATTGTGGACATGG + Intergenic
958041206 3:88228921-88228943 CAGACAACTCTTTGTTGTGAGGG - Intergenic
958852737 3:99348635-99348657 CAGCCAACTTACAGTGGTACTGG - Intergenic
961290816 3:125845316-125845338 CAGCCAACCCATTGTGGACATGG - Intergenic
961896305 3:130170879-130170901 CAGCCAACCCATTGTGGACATGG + Intergenic
969006480 4:4024223-4024245 CAGCCAACCCATTGTGGACATGG + Intergenic
969273025 4:6115854-6115876 CTGCCAACTCTTTGGGCTGCCGG + Intronic
969806482 4:9613079-9613101 CAGCCAACCCATTGTGGACATGG - Intergenic
972373664 4:38450040-38450062 CAGCCTCCTCAATGTTGTGCAGG - Intergenic
973886228 4:55324862-55324884 TAGCCAATTCCTTGTGGTGTTGG - Intergenic
978969538 4:114786375-114786397 CAGCCAAAACAGTGTGGTACTGG + Intergenic
980544994 4:134248172-134248194 CAGAGGAATCATTGTGGTGCTGG + Intergenic
982547050 4:156747170-156747192 AAGCCAACACATTGAGATGCAGG + Intergenic
986043330 5:4013673-4013695 CAGACATCTCATTGTGGCGGTGG + Intergenic
987207864 5:15645820-15645842 CAGCCAAGTCATTTTGTTACTGG - Intronic
992454128 5:76901144-76901166 CAGCACAGTCATTGTGGTGGTGG - Intronic
992534941 5:77690468-77690490 CAGCCAAATTATGGTGGAGCTGG + Intergenic
995608686 5:113886747-113886769 CAGCCATCACAATGTGGAGCAGG - Intergenic
996176645 5:120368088-120368110 CCGCCAACTCAGTAGGGTGCAGG - Intergenic
997138929 5:131357867-131357889 CAGCAAACACAGTGTGGCGCTGG - Intronic
997617184 5:135255545-135255567 TAGACAACTCTCTGTGGTGCAGG + Intronic
1000651225 5:163821551-163821573 CAGCCCAGTCATAGTGGTGGTGG - Intergenic
1000886014 5:166748274-166748296 AAGCCAAATCATTGTGTTACTGG + Intergenic
1004965250 6:20841963-20841985 CAGCCATCTCATTTTGGTTTTGG + Intronic
1011763379 6:90592555-90592577 TAGCCAACTCATGGAGCTGCAGG + Intergenic
1012135119 6:95545871-95545893 GAGTCAAATCATTGTGATGCAGG - Intergenic
1014760213 6:125347779-125347801 CAGCCAACTCATACTGGCTCAGG - Intergenic
1020327016 7:6982515-6982537 CAGCCAACCCATTGTGGACATGG + Intergenic
1023175010 7:37427498-37427520 CAGCCATCCCATAGTGGTGTTGG - Intronic
1023221997 7:37929038-37929060 CAGCTCACTCATTGTGGACCTGG + Intronic
1026290646 7:69002825-69002847 TGGTGAACTCATTGTGGTGCTGG + Intergenic
1029602454 7:101576355-101576377 CAACAAACTCTTTGTGGTGGGGG - Intergenic
1034395211 7:150818390-150818412 CAATCAACACATTGTGGTACTGG + Intergenic
1034678640 7:152910979-152911001 GAGCCATCTCAGTGTGGGGCAGG + Intergenic
1036369620 8:8151572-8151594 CAGCCAACCCATTGTGGACATGG - Intergenic
1036881269 8:12514072-12514094 CAGCCAACCCATTGTGGACATGG + Intergenic
1045956021 8:107909031-107909053 CAGCCAACTCATTGTGGTGCTGG - Intronic
1050351866 9:4747822-4747844 CAGCCATTTCAATGTGTTGCTGG - Intergenic
1050879818 9:10685238-10685260 CAGCCACCTCCTTGGGATGCAGG + Intergenic
1055562026 9:77530734-77530756 CAGCCAACCCACTGTCTTGCAGG + Intronic
1055654253 9:78437555-78437577 CAGACAATTCTTTGTGGTGAGGG + Intergenic
1058226024 9:102365156-102365178 CAGCCAGATCTTTGTGGAGCAGG + Intergenic
1060931639 9:127492761-127492783 CCGCCAGCTCACGGTGGTGCGGG + Intronic
1061399795 9:130362098-130362120 CAGCCACATCAGTGTGGGGCTGG - Intronic
1186651801 X:11569270-11569292 CAGACAATTCTTTGTGGTGGGGG - Intronic
1187996155 X:24929127-24929149 TAGCCAACCCAATTTGGTGCAGG - Intronic
1190138597 X:47820009-47820031 CAGCAAACTGGTTGTGGGGCAGG - Intergenic
1192274257 X:69614087-69614109 CAGCCATCTCCTGGTGGTGATGG - Intergenic
1193660933 X:84257515-84257537 CAACCACCTCATTTTGGTGCTGG + Intergenic
1194083482 X:89498209-89498231 CAGCACAGTCATTGTGGTGTTGG - Intergenic
1197348368 X:125351145-125351167 CAGCACACTCATAGTGGTGGTGG + Intergenic
1199318796 X:146413919-146413941 CAGCCAACTCATAGTGCCCCTGG + Intergenic
1200436131 Y:3154090-3154112 CAGCACAGTCATTGTGGTGTTGG - Intergenic
1200695893 Y:6359281-6359303 CAGCCAAATGATTGTGGTTCAGG + Intergenic
1200827956 Y:7662392-7662414 CAGCCAAACGATTGTGGTTCAGG - Intergenic
1200884714 Y:8255672-8255694 CAGCCAAATGACTGTGGTTCAGG - Intergenic
1200940941 Y:8781016-8781038 CAGCCAAATGATTGTGGTTCAGG - Intergenic
1200953822 Y:8926188-8926210 CAGCCAAGTGATTGTGGTTCAGG + Intergenic
1200957663 Y:8968572-8968594 CAGCCAAATGATTGTGGTTCAGG + Intergenic
1201039384 Y:9815425-9815447 CAGCCAAATGATTGTGGTTCAGG - Intergenic
1201057900 Y:10014069-10014091 AAGCCAAATGATTGTGGTTCAGG - Intergenic
1202107675 Y:21387084-21387106 CAGCCAAATGATTGTGGTTCAGG - Intergenic
1202119014 Y:21505720-21505742 CAGCCAAATGAATGTGGTTCAGG + Intergenic
1202121466 Y:21529260-21529282 CAGCCAAATGAATGTGGTTCAGG + Intronic
1202123912 Y:21552829-21552851 CAGCCAAATGATTGTGGTTCTGG + Intergenic
1202155096 Y:21876551-21876573 CAGCCAAATGATTGTGGTTCTGG - Intergenic
1202157537 Y:21900122-21900144 CAGCCAAATGAATGTGGTTCAGG - Intronic
1202159986 Y:21923663-21923685 CAGCCAAATGAATGTGGTTCAGG - Intergenic
1202183985 Y:22165046-22165068 CAGCCAAATGAATGTGGTTCAGG - Intergenic
1202196131 Y:22299595-22299617 CAGCCAAATGATTGTGGTTCAGG - Intergenic
1202199271 Y:22330023-22330045 AAGCCAAATGATTGTGGTTCAGG + Intronic
1202207374 Y:22421355-22421377 CAGCCAAATGAATGTGGTTCAGG + Intergenic
1202231942 Y:22667567-22667589 CAGCCAAATGATTGTGGTTCAGG + Intergenic
1202311214 Y:23528591-23528613 CAGCCAAATGATTGTGGTTCAGG - Intergenic
1202559588 Y:26142003-26142025 CAGCCAAATGATTGTGGTTCAGG + Intergenic