ID: 1045957804

View in Genome Browser
Species Human (GRCh38)
Location 8:107929412-107929434
Sequence CTGGCTTTCAGCTGCTAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 178}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045957804_1045957805 -10 Left 1045957804 8:107929412-107929434 CCTGTTTAGCAGCTGAAAGCCAG 0: 1
1: 0
2: 0
3: 7
4: 178
Right 1045957805 8:107929425-107929447 TGAAAGCCAGCCAGATCCTGTGG No data
1045957804_1045957806 -5 Left 1045957804 8:107929412-107929434 CCTGTTTAGCAGCTGAAAGCCAG 0: 1
1: 0
2: 0
3: 7
4: 178
Right 1045957806 8:107929430-107929452 GCCAGCCAGATCCTGTGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045957804 Original CRISPR CTGGCTTTCAGCTGCTAAAC AGG (reversed) Intronic
900441068 1:2655575-2655597 CAGGCTGTCAGATGCTAACCTGG - Intronic
900441196 1:2656258-2656280 CAGGCTTTCAGATGCTCACCTGG - Intronic
900446512 1:2683796-2683818 CCGGCTGTCAGATGCTCAACTGG - Intronic
900447285 1:2687689-2687711 CCGGCTGTCAGATGCTCAACTGG - Intronic
900448898 1:2695718-2695740 CAGGATTTCAGCTGCTCACCTGG - Intronic
900448913 1:2695798-2695820 CAGGCTGTCAGATGCTCAACTGG - Intronic
900449375 1:2698048-2698070 CAGGCTGTCAGATGCTCAACTGG - Intronic
900450057 1:2701463-2701485 CAGGCTGTCAGATGCTAACCTGG - Intronic
900452366 1:2756669-2756691 CAGGATTTCAGCTGCTCACCTGG - Intronic
900452380 1:2756749-2756771 CAGGCTGTCAGATGCTCAACTGG - Intronic
900452843 1:2758999-2759021 CAGGCTGTCAGATGCTCAACTGG - Intronic
900453544 1:2762574-2762596 CAGGCTGTCAGATGCTAACCTGG - Intronic
900454257 1:2766159-2766181 CAGGCTGTCAGATGCTAACCTGG - Intronic
900454562 1:2767769-2767791 CAGGCTGTCAGATGCTCAACTGG - Intronic
900454718 1:2768583-2768605 CAGGCTTTCAGCTGCTCACCTGG - Intronic
900454986 1:2769835-2769857 CAGGCTGTCAGATGCTAACCTGG - Intronic
900455736 1:2773581-2773603 CAGGCTGTCAGATGCTAACCTGG - Intronic
900456080 1:2775394-2775416 CAGGCTGTCAGATGCTCAACTGG - Intronic
900456234 1:2776208-2776230 CAGGCTTTCAGCTGCTCACCTGG - Intronic
904504645 1:30940817-30940839 CTTTCTTTCAGGTGCTAAAAAGG + Intronic
905368764 1:37471465-37471487 TTGGCTTTCAGTTGCTTCACTGG - Intergenic
905770239 1:40633142-40633164 CTGGCTTTCAGCCCCTAGCCGGG + Exonic
907316637 1:53576666-53576688 CTGGATTCCAGCTGCTAAGAAGG + Intronic
907834318 1:58094469-58094491 GTGGCTTGCAGTTGCTAACCAGG + Intronic
907990833 1:59580928-59580950 GTGCATTTCAACTGCTAAACAGG - Intronic
908383346 1:63617251-63617273 CTGGCTCACAGCTGGCAAACAGG + Intronic
917928405 1:179807456-179807478 CTGGCTTTCTCCTGCTCCACTGG - Intronic
918013673 1:180611481-180611503 CCTGCCTTCAGCTGCTAAAGAGG + Intergenic
920028444 1:203019165-203019187 GTGGATTTCAGATGCTCAACTGG + Intronic
921762639 1:218934350-218934372 CTGTCTTTGAGCTGGGAAACTGG - Intergenic
923465052 1:234240942-234240964 CTGGCTTTCAGCTCATATCCTGG - Intronic
1063513441 10:6670335-6670357 CTAGCTTTCATGTGATAAACAGG + Intergenic
1065076034 10:22080310-22080332 CTGGCTTTCAGGTGCCACAGGGG + Intergenic
1070940220 10:80337861-80337883 CTGGCTTACATCTGCTGATCCGG + Intronic
1077267795 11:1660806-1660828 CTGACATTCAGCTTCTAAGCAGG - Intergenic
1081596262 11:44461691-44461713 CTGTCCTTCAGCTCCTAAAAAGG - Intergenic
1083304505 11:61755429-61755451 CTGGCTTCCAGCAGGTAACCGGG + Intronic
1091872464 12:3905981-3906003 CTGGCTTTCAGCAGTTAGCCTGG + Intergenic
1092525794 12:9309596-9309618 CAGGCTTTCACCTGCTAGACTGG - Intergenic
1092541495 12:9422221-9422243 CAAGCTTTCACCTGCTAGACTGG + Intergenic
1094511547 12:31100283-31100305 CAGGCTTTCACCTGTTAGACTGG - Intronic
1098885950 12:75961066-75961088 CTGGTTTTGAACTCCTAAACTGG + Intergenic
1099307134 12:80971444-80971466 CTGCCTCTCAGCTGCTACTCTGG - Intronic
1100153705 12:91772404-91772426 CTTGCTCTCAACTGCTAAATAGG + Intergenic
1105298995 13:19116743-19116765 CTGGCTTGGAGCAGCTAAGCAGG + Intergenic
1110470377 13:75853367-75853389 CAGGCTCTCAGCTGCGTAACAGG + Exonic
1111225332 13:85263827-85263849 CTGCCTTTGAGCTGCTACTCTGG + Intergenic
1116729425 14:48603301-48603323 CTGGCTCTTACCTGCCAAACAGG + Intergenic
1117656231 14:57959604-57959626 ATGGCTTTCGGCTGCGAAAGTGG - Intronic
1118238221 14:64031168-64031190 CAGGCTTGCATCTGCTAAGCAGG + Exonic
1120198695 14:81514718-81514740 CTGTCTTTCAGATGGGAAACAGG + Intronic
1121262062 14:92573579-92573601 CTGAGTTTCTGCTACTAAACAGG - Intronic
1122659019 14:103282025-103282047 CTGGCTGCCAGCTGCTGGACAGG + Intergenic
1123072422 14:105648226-105648248 CTGGACCTCAGCTGCTGAACAGG - Intergenic
1124077571 15:26460858-26460880 CTGGCTTTCAGTGACTAAAATGG + Intergenic
1128263812 15:66251746-66251768 CTTGCTTAGAGCTGCTATACGGG - Intronic
1132648038 16:1008006-1008028 CTGGCTTTCCACTGCCCAACCGG - Intergenic
1134826653 16:17290181-17290203 GTGGCTTTCAGCCTCTAAACTGG - Intronic
1135275416 16:21108224-21108246 CTGGAGTTCAGCTGCCAACCTGG + Intronic
1138210871 16:55162263-55162285 CTAGCTGTCAGCAGCAAAACAGG - Intergenic
1139888236 16:70226230-70226252 CTTGCTTTCTACTGCTAAATGGG - Intergenic
1142332727 16:89465531-89465553 CCTGCTTTCAGCTGCTCAGCAGG + Intronic
1146530707 17:33605561-33605583 CATGCTTTATGCTGCTAAACTGG + Intronic
1150983959 17:70174450-70174472 CAGTCTTTCATCTGCTTAACAGG + Intronic
1151476947 17:74349493-74349515 CTAGCATTCAGCTGTTAAATGGG + Intronic
1153524253 18:5979685-5979707 CTGCCTGTCACCTTCTAAACAGG - Intronic
1153599423 18:6764568-6764590 CAGGCTTTCAGCTCCTGAAGAGG - Intronic
1156180745 18:34601195-34601217 CTGCCTCTCAGCTGCTACTCTGG - Intronic
1156198390 18:34802241-34802263 CTGGCTGTCAGCTGCAACCCAGG - Intronic
1157897062 18:51479205-51479227 CTGCCTTTTAGCTGCTACTCTGG - Intergenic
1160354582 18:78216181-78216203 CTGTCTTTCAGCTCCTGCACTGG + Intergenic
1161965147 19:7543617-7543639 CTGACTTTCAGCTGGTAGTCGGG - Intronic
1161970701 19:7578278-7578300 CTGCCTCTCAGCTGCTATTCTGG - Intergenic
1168192041 19:54745784-54745806 ATGGCTTTTAGCTGCAAGACAGG - Intronic
1168194321 19:54762341-54762363 ATGGCTTTTAGCTGCAAGACAGG - Intronic
1168196374 19:54777062-54777084 ATGGCTTTTAGCTGCAAGACAGG - Intronic
1168204731 19:54841318-54841340 ATGGCTTTTAGCTGCAAGACAGG - Intronic
924967576 2:92350-92372 CTGGGTTTCAAGTGCAAAACTGG + Intergenic
927171633 2:20375291-20375313 CTGGCTTCCAGCTCCAACACTGG + Intergenic
927177278 2:20419627-20419649 CTGGCTTCCAGCTCCAACACTGG + Intergenic
927231111 2:20825073-20825095 CTGCCTTTCAGATGCTACTCTGG + Intergenic
931972126 2:67600438-67600460 CTGCCTTTGAGCTGCTACTCTGG - Intergenic
935704949 2:105848308-105848330 CTGGCTTTCTGCAGCTGAAGAGG + Intronic
937332137 2:121038290-121038312 CTGCCTTTCTGCTGCTGAAAGGG + Intergenic
938287070 2:130127827-130127849 CTGGCTTGGAGCAGCTAGACGGG + Intronic
938428524 2:131211043-131211065 CTGGCTTGGAGCAGCTAGACCGG - Intronic
938469425 2:131545061-131545083 CTGGCTTGGAGCAGCTAGACGGG - Intergenic
943094843 2:183416649-183416671 CTGGGTTTCAAGTGCAAAACTGG + Intergenic
945321198 2:208425523-208425545 CTGCCTTTGAGCTGCTACTCTGG + Intronic
1172092955 20:32446600-32446622 CTGGCCCTCAGCTGCTTGACAGG - Exonic
1172803850 20:37597471-37597493 CTGGCTCTAAGCTGCTACTCTGG + Intergenic
1175500300 20:59445410-59445432 CTGGAATTCAGCTGCAAAAATGG + Intergenic
1182238337 22:28894639-28894661 CAGGCTTTCTGCTTCTGAACAGG + Intronic
1183960921 22:41411448-41411470 CTCTCTATCAGCAGCTAAACTGG - Intergenic
949801238 3:7906430-7906452 CTGGGTTTCAAGTGCAAAACTGG - Intergenic
950851922 3:16070333-16070355 CTGGCTTGCAGCTGCCCCACTGG - Intergenic
951243087 3:20309319-20309341 CTGGGTTTCAGATGCTAGAATGG - Intergenic
952134135 3:30398228-30398250 CAGGCCATCAGCTGCTAAACTGG + Intergenic
952708763 3:36407763-36407785 GTTGCTTTAAGCTGCTAAATTGG - Intronic
953180509 3:40590271-40590293 CTGGCAGTCAGCAGCCAAACTGG - Intergenic
954643850 3:52118653-52118675 CTGGCTTTCGACTGCTACGCTGG + Intronic
954644862 3:52124980-52125002 GTGGCTTTCAGCGACTAAAAAGG - Intronic
955120933 3:56057583-56057605 CTTGTTTTCATCTGTTAAACTGG + Intronic
956197594 3:66668854-66668876 CTGTCTTTGAGCTGCTACTCTGG + Intergenic
956336377 3:68168539-68168561 CTGGATTTCAACTCCTAGACTGG - Intronic
957501731 3:81066640-81066662 CTGGCTTTCTCCTGCTACCCAGG + Intergenic
957843620 3:85701703-85701725 CTGCATATCAGCTTCTAAACTGG + Intronic
958027742 3:88068854-88068876 CTGGCTTTTGGCTGTCAAACTGG - Intronic
961550347 3:127667361-127667383 CTGGCTCTCAGCTGCATAGCAGG + Intronic
961727938 3:128945145-128945167 CTGGCTTCCACCTGCTGGACGGG - Exonic
962695819 3:137946090-137946112 CTGGCTTTCAGATGCTGCTCTGG + Intergenic
963694112 3:148542847-148542869 CTGTCTTTCATCTGTTCAACTGG + Intergenic
964053060 3:152419622-152419644 CTGGCTTTCAGGCACAAAACTGG + Intronic
964390111 3:156187827-156187849 CTGGCTTACAGCTTCAAATCTGG + Intronic
965036078 3:163439721-163439743 CTTATTTTCAGCTTCTAAACTGG - Intergenic
965678343 3:171223623-171223645 CTGGCTTTCACATCCTAAAATGG + Intronic
966842923 3:184104193-184104215 CTGGGTTCCAGCTGATAAATGGG - Exonic
967367138 3:188699984-188700006 CAGGCTTTCAGCTCTAAAACGGG + Intronic
967697018 3:192543855-192543877 CTGTCTTTCTGTGGCTAAACTGG + Intronic
967707502 3:192668558-192668580 CTGGTTTTCTGCTGGTACACAGG + Intronic
970790997 4:19857519-19857541 TTTGCTTTCAGCTGCTAGTCAGG + Intergenic
971276474 4:25202550-25202572 CTGGACTTCAGGTGTTAAACTGG + Intronic
972377550 4:38486668-38486690 CTGGCATGCACCTGCTTAACAGG + Intergenic
975491154 4:74990126-74990148 GTGCCTTTCATCTCCTAAACAGG - Intronic
975697593 4:77028925-77028947 CTGTCTTACAGATGATAAACAGG + Intronic
976131646 4:81891087-81891109 AGGGCTTTCCTCTGCTAAACTGG - Intronic
978348109 4:107793006-107793028 CTGGCTTTCAGTTCCTCAAAAGG + Intergenic
980185266 4:129453332-129453354 CTGGCTCTGAGCTGTGAAACAGG + Intergenic
981406024 4:144370365-144370387 ATGGATTTCAGCTGCCAAAAAGG + Intergenic
981985474 4:150849427-150849449 ATTGCTTTCAGCTGCTACATCGG - Exonic
989550457 5:42728917-42728939 CTGGATTTCATTTTCTAAACTGG - Intergenic
989692048 5:44156272-44156294 CTGGCTTTTAGATGCTACAGAGG + Intergenic
997089130 5:130835919-130835941 CTGGCTTGCAGGTGTTAAAAGGG - Intergenic
997467125 5:134095721-134095743 GTGGCTGGTAGCTGCTAAACTGG - Intergenic
999832381 5:155332909-155332931 CTCGCTGTCAGCTGCTATAGTGG + Intergenic
1001421927 5:171594065-171594087 CTGGCTTTCAGCTCTGAAATGGG + Intergenic
1002830537 6:816455-816477 CTGGCTTTCACACGCTAACCAGG - Intergenic
1005204994 6:23392568-23392590 CTTGTTTTCAGCCGCTAAATTGG + Intergenic
1007363607 6:41374988-41375010 CTGGGTTTCAGCTGGCAAAAAGG - Intergenic
1008670953 6:53768261-53768283 CTGTCTTCTAGTTGCTAAACTGG + Intergenic
1012229581 6:96745284-96745306 CTGGCTTATAGCTGAGAAACAGG - Intergenic
1012583487 6:100895971-100895993 CTGGCTTTTAGATGCTACAGAGG + Intergenic
1013174326 6:107664207-107664229 CAGTCTTTCAGCTGGTCAACTGG - Intergenic
1016239158 6:141908313-141908335 CTGCCTTTCAGCTGCTACTCTGG - Intergenic
1016256020 6:142106295-142106317 CTGGCTTGCAGTTGCTAGTCTGG + Intergenic
1016591233 6:145745998-145746020 CTGGCTCTCCCCTGGTAAACAGG - Intergenic
1017561742 6:155635631-155635653 GTGTCTTTAAGCTGCTTAACAGG - Intergenic
1022716688 7:32905342-32905364 CTGCCTTTGAGCTGCTACTCTGG - Intergenic
1024347384 7:48326855-48326877 CTGGCCTTAAGCTGCCAAATTGG + Intronic
1025758154 7:64365033-64365055 CTGGCTTTTTGGTGCTAAAGAGG - Intergenic
1026222940 7:68416041-68416063 CTGCCTTTGAGCTGCTACTCTGG + Intergenic
1027194301 7:76018753-76018775 GTGTCTATCAGCAGCTAAACAGG - Intronic
1027250599 7:76396441-76396463 CTGCCTCTCAGCTGCTACTCTGG + Intronic
1027444363 7:78255514-78255536 CTGGCTTCCACCTGCTAGCCTGG + Intronic
1029427652 7:100506576-100506598 CTGCCTCTCAGCTGCTATTCTGG - Intergenic
1030713704 7:112785042-112785064 CTGGATTTCAGTTTTTAAACTGG - Intronic
1032538218 7:132682383-132682405 CTGGCTTACTGCTGCAAGACAGG - Intronic
1034104769 7:148480912-148480934 TTGGCTCTCAGCTGCTCAAGAGG - Intergenic
1036564278 8:9925023-9925045 CTGGAATTCAGCTGCTTAAAAGG - Intergenic
1036697780 8:10989571-10989593 CTGGGTTTCAACTGATGAACAGG + Intronic
1036921002 8:12855284-12855306 CAATCTTTCAGCTGCTTAACTGG - Intergenic
1037719610 8:21431399-21431421 CTGGGTTTCAACTACAAAACTGG + Intergenic
1038448988 8:27626839-27626861 CTGCCTCTGAGCTGCTAACCTGG + Intergenic
1038452086 8:27646319-27646341 CTGGCTAACAGTTGCTAATCTGG + Intronic
1040374297 8:46808532-46808554 CTGGCTGTTAGATGCTAAAGAGG - Intergenic
1040878839 8:52181868-52181890 CTGGCTTTGAGGGGCTGAACAGG + Intronic
1041407483 8:57515939-57515961 CTGGCTTTTATCTGCAAAGCAGG + Intergenic
1042635917 8:70874646-70874668 CTGGCTTGAAGCTGAAAAACAGG + Intergenic
1043630716 8:82328450-82328472 CTTTCTTTCAGTTGCTTAACTGG - Intergenic
1043946809 8:86262716-86262738 CTGGCTTTGAGTTCCAAAACAGG - Intronic
1045114877 8:98971982-98972004 CTTGCTTTCAGCTGCTTAAGTGG - Intergenic
1045957804 8:107929412-107929434 CTGGCTTTCAGCTGCTAAACAGG - Intronic
1047348526 8:124051475-124051497 CTGGGTTTCACCTGCAAAATGGG + Intronic
1049785837 8:144450293-144450315 CTGGCTGGCAGCTGCTTCACAGG - Exonic
1050253430 9:3769770-3769792 ATGGCTTTCATCTGGTAATCTGG + Intergenic
1050895292 9:10879152-10879174 CTGGCTTTCAGATCCTTCACTGG - Intergenic
1052675552 9:31617730-31617752 CTTGTTTTAAGCTGCTAAATTGG + Intergenic
1052801142 9:32969485-32969507 CTGTGATTCAGCTGCTCAACTGG + Intergenic
1054768817 9:69066041-69066063 CAGGCTTTCAGATGCTATGCAGG - Intronic
1057571282 9:96206027-96206049 TTGGCTTTTAGCAGCCAAACTGG - Intergenic
1060200660 9:121650311-121650333 CTGGCTTCCAGCTGTGAGACAGG + Intronic
1062093044 9:134688601-134688623 GTGGCTTTCGGCTGCCAAGCAGG - Intronic
1188600291 X:31955256-31955278 CAGGCTTGAAGCTGTTAAACTGG + Intronic
1195792281 X:108601382-108601404 CTTGCTTTCAGGTCCTAAAGGGG + Exonic
1198720622 X:139615371-139615393 GTGGCTTTCTTATGCTAAACAGG - Intronic
1201460875 Y:14222602-14222624 CTGCCTTTCAGCTTTCAAACTGG + Intergenic