ID: 1045959138

View in Genome Browser
Species Human (GRCh38)
Location 8:107946504-107946526
Sequence CTGTGGGACTGGGGCACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045959132_1045959138 -7 Left 1045959132 8:107946488-107946510 CCACGAACGGACAAACCTGTGGG 0: 1
1: 0
2: 0
3: 4
4: 32
Right 1045959138 8:107946504-107946526 CTGTGGGACTGGGGCACAGAAGG No data
1045959130_1045959138 -6 Left 1045959130 8:107946487-107946509 CCCACGAACGGACAAACCTGTGG 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1045959138 8:107946504-107946526 CTGTGGGACTGGGGCACAGAAGG No data
1045959128_1045959138 8 Left 1045959128 8:107946473-107946495 CCTAGGGAGAGGTGCCCACGAAC 0: 1
1: 0
2: 1
3: 12
4: 89
Right 1045959138 8:107946504-107946526 CTGTGGGACTGGGGCACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045959138 Original CRISPR CTGTGGGACTGGGGCACAGA AGG Intronic
No off target data available for this crispr