ID: 1045960687

View in Genome Browser
Species Human (GRCh38)
Location 8:107964640-107964662
Sequence ACAGAGCAGGGGGTTGTAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 224}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045960687_1045960693 -3 Left 1045960687 8:107964640-107964662 CCAACTACAACCCCCTGCTCTGT 0: 1
1: 0
2: 3
3: 30
4: 224
Right 1045960693 8:107964660-107964682 TGTTCAGCCATTTCTCCAGGAGG No data
1045960687_1045960696 17 Left 1045960687 8:107964640-107964662 CCAACTACAACCCCCTGCTCTGT 0: 1
1: 0
2: 3
3: 30
4: 224
Right 1045960696 8:107964680-107964702 AGGTAACTCTTCTGCTTTGCAGG No data
1045960687_1045960697 18 Left 1045960687 8:107964640-107964662 CCAACTACAACCCCCTGCTCTGT 0: 1
1: 0
2: 3
3: 30
4: 224
Right 1045960697 8:107964681-107964703 GGTAACTCTTCTGCTTTGCAGGG No data
1045960687_1045960699 20 Left 1045960687 8:107964640-107964662 CCAACTACAACCCCCTGCTCTGT 0: 1
1: 0
2: 3
3: 30
4: 224
Right 1045960699 8:107964683-107964705 TAACTCTTCTGCTTTGCAGGGGG No data
1045960687_1045960698 19 Left 1045960687 8:107964640-107964662 CCAACTACAACCCCCTGCTCTGT 0: 1
1: 0
2: 3
3: 30
4: 224
Right 1045960698 8:107964682-107964704 GTAACTCTTCTGCTTTGCAGGGG No data
1045960687_1045960703 26 Left 1045960687 8:107964640-107964662 CCAACTACAACCCCCTGCTCTGT 0: 1
1: 0
2: 3
3: 30
4: 224
Right 1045960703 8:107964689-107964711 TTCTGCTTTGCAGGGGGTGGGGG No data
1045960687_1045960692 -6 Left 1045960687 8:107964640-107964662 CCAACTACAACCCCCTGCTCTGT 0: 1
1: 0
2: 3
3: 30
4: 224
Right 1045960692 8:107964657-107964679 CTCTGTTCAGCCATTTCTCCAGG No data
1045960687_1045960700 23 Left 1045960687 8:107964640-107964662 CCAACTACAACCCCCTGCTCTGT 0: 1
1: 0
2: 3
3: 30
4: 224
Right 1045960700 8:107964686-107964708 CTCTTCTGCTTTGCAGGGGGTGG No data
1045960687_1045960701 24 Left 1045960687 8:107964640-107964662 CCAACTACAACCCCCTGCTCTGT 0: 1
1: 0
2: 3
3: 30
4: 224
Right 1045960701 8:107964687-107964709 TCTTCTGCTTTGCAGGGGGTGGG No data
1045960687_1045960704 27 Left 1045960687 8:107964640-107964662 CCAACTACAACCCCCTGCTCTGT 0: 1
1: 0
2: 3
3: 30
4: 224
Right 1045960704 8:107964690-107964712 TCTGCTTTGCAGGGGGTGGGGGG No data
1045960687_1045960702 25 Left 1045960687 8:107964640-107964662 CCAACTACAACCCCCTGCTCTGT 0: 1
1: 0
2: 3
3: 30
4: 224
Right 1045960702 8:107964688-107964710 CTTCTGCTTTGCAGGGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045960687 Original CRISPR ACAGAGCAGGGGGTTGTAGT TGG (reversed) Intronic
901442823 1:9289806-9289828 GCAGAGCTGGGGGTTGCATTGGG + Intergenic
901672062 1:10861865-10861887 ACAGACCAGGGGGTGGGACTTGG - Intergenic
904910722 1:33932249-33932271 ACAGAGAATGGGGTTGGAGGTGG + Intronic
904925784 1:34047187-34047209 AGTGAGCAGGGGGAGGTAGTTGG - Intronic
905157033 1:35993721-35993743 AAAAAGCAGGGGGTGGTGGTTGG - Intronic
905535304 1:38716713-38716735 ACTGCCCAGGAGGTTGTAGTAGG - Intergenic
906081080 1:43088722-43088744 ACAGAATAAGGGGTTGTAGAGGG - Intergenic
907105763 1:51881144-51881166 TCAGAGCAGTGGGTTGTTGTTGG + Intergenic
908281940 1:62548765-62548787 ACAGAGCACAGGGTAGAAGTAGG + Intronic
911586041 1:99692143-99692165 ACCAATCAGGGGGTAGTAGTTGG + Intronic
914390918 1:147222382-147222404 AGAGAGCAGGGGATGGAAGTTGG + Intronic
915735932 1:158084991-158085013 ACAGAGCGGGGGTTTGTACCTGG + Intronic
917201204 1:172517420-172517442 ACATATCAGGGGGTTGTAGGAGG - Intergenic
917853829 1:179086079-179086101 ACAGAGCAGGGGGTGGTGTTTGG - Intronic
919350494 1:196447246-196447268 ACAGAGCAGTTGGTGGTAGATGG + Intronic
921880952 1:220253508-220253530 AGAGAGTAGGGGGCGGTAGTCGG + Intronic
921903460 1:220472349-220472371 ACTGTGCAGGAGGTAGTAGTCGG + Intergenic
923461462 1:234213100-234213122 AGAGAGCTGGGGGTTGCAGGTGG + Intronic
1064188291 10:13183032-13183054 ACGGAGCAGGGGACTGTCGTAGG + Exonic
1067130758 10:43563164-43563186 AAATAGCAGGGTGTGGTAGTGGG + Intronic
1068954828 10:62813304-62813326 CCAGAGCAGGAGGCTGTAGAGGG + Exonic
1071253305 10:83842619-83842641 ACAGAGCTGGTGGCTGCAGTTGG + Intergenic
1072231944 10:93421402-93421424 CCCTAGCAGGGGGTTGCAGTAGG + Intronic
1073582180 10:104678801-104678823 ACAGAGCAGGGCTTTGTGATGGG - Intronic
1073977541 10:109118064-109118086 ACAGAAGAGGGGGATGGAGTGGG - Intergenic
1074722675 10:116276193-116276215 GCAGTACTGGGGGTTGTAGTTGG + Intergenic
1075387723 10:122069153-122069175 ACAGAGAAGGGGGTTCCAGGTGG - Intronic
1075898258 10:126017038-126017060 ACAGTGCAGTGCGCTGTAGTAGG - Exonic
1076540503 10:131211413-131211435 ACCGGGAAAGGGGTTGTAGTAGG - Intronic
1076764544 10:132625745-132625767 ACGGAGCAGGGGGTTCTGGAGGG + Intronic
1076790325 10:132773779-132773801 ACAGAGCAGGAGGCTGTCCTGGG - Intronic
1077280113 11:1740542-1740564 ACTGAACAGGGAGTTGTAGAAGG + Intronic
1077724572 11:4661377-4661399 ATAGTGCAGGGGGTTGGAGATGG + Intergenic
1077790227 11:5431202-5431224 ATAGCGCAGGAGGTTGTAGATGG + Intronic
1077995636 11:7449912-7449934 ACAGGGGAGGGGGTGGTAGTTGG - Intronic
1080126702 11:28743417-28743439 CCAGGGCAGGGAGTTGAAGTAGG - Intergenic
1080746705 11:35114881-35114903 AGATACCAGGGGGCTGTAGTTGG + Intergenic
1082661270 11:55914187-55914209 ATAGAGCAGGGGGTTGATGATGG + Exonic
1082670484 11:56030792-56030814 ATAGAGCAGTGGGTTGCAGATGG - Exonic
1083023688 11:59532125-59532147 ACAGTGCAGGGGCTTGAAGATGG - Intergenic
1083067352 11:59938851-59938873 ACAGAGGAGTGGGTGGTGGTAGG + Intergenic
1083302663 11:61747068-61747090 GCAGAGCAGGGGGTTGGCATGGG + Intergenic
1085348022 11:75780651-75780673 ACAAAGCAGGGGGCAGTGGTGGG - Intronic
1086380135 11:86244454-86244476 ACAGAGGAGGGGCTTGGAGGAGG + Intergenic
1088751788 11:112848142-112848164 ACATAGCAGGGGGATGCAGGAGG - Intergenic
1088877182 11:113945772-113945794 ACTGAGCAGTGGGTTGTGTTTGG - Intronic
1090154612 11:124424479-124424501 GTAGAGCAGGGGGTTGCAGATGG + Exonic
1091208973 11:133840836-133840858 ACACAGCAGGGAGATGTGGTTGG + Exonic
1093804275 12:23412626-23412648 CCAGAGCAGGGGGTAGTTTTGGG - Intergenic
1093880875 12:24403046-24403068 ACAGAGAATGGGATTGGAGTAGG - Intergenic
1095410337 12:41914522-41914544 TCAGATCAGAAGGTTGTAGTAGG + Intergenic
1096597597 12:52706632-52706654 ACAGAGCAGGGGGAAGAAGTAGG + Intergenic
1097316620 12:58178122-58178144 ACAGAGCAGAGGACTGTAGAAGG + Intergenic
1101258541 12:103005321-103005343 ACACAGCAGGCTGTTGGAGTTGG - Intergenic
1101452951 12:104797229-104797251 ACTGAGAAGGGGCTTTTAGTAGG + Intergenic
1101727213 12:107398035-107398057 ACACAGCAGGGGGATTTAGAAGG + Intronic
1104134094 12:125921218-125921240 ACGGAGCAGGTGGATGGAGTCGG - Intergenic
1108114907 13:47116485-47116507 ACAGAGCAGGGGTCTGTAGGGGG + Intergenic
1116280696 14:42903283-42903305 AAAAAGGAGAGGGTTGTAGTTGG + Intergenic
1116947458 14:50848958-50848980 AAAGAGCTGAGGGTGGTAGTGGG - Intergenic
1117033520 14:51702363-51702385 AATGAGTAGGGGCTTGTAGTAGG - Intronic
1118692540 14:68353685-68353707 ACAGAGCCGGGCGTTGGGGTTGG + Intronic
1118791908 14:69101715-69101737 ACATAGCTGGGGTGTGTAGTAGG - Intronic
1120169730 14:81236401-81236423 ACAGAGCAGGGGGTGGCGGGGGG - Intergenic
1120425451 14:84341691-84341713 ACAGAGCCGGGGGTGGGGGTGGG - Intergenic
1122471502 14:101970277-101970299 CCAGAGCAGGGAGTGGTTGTGGG + Intronic
1123408918 15:20042370-20042392 ACAGATCACGTGGTTGTAGCTGG - Intergenic
1123518248 15:21049080-21049102 ACAGATCACGTGGTTGTAGCTGG - Intergenic
1125186807 15:36940307-36940329 AATGAGCAGGGGGTTTAAGTAGG - Intronic
1125753789 15:42048793-42048815 ACAGAGCAAGGGATTGAAGCTGG + Intronic
1126322965 15:47445196-47445218 ACAGAAGAGGGGGGTGTGGTGGG + Intronic
1126470082 15:49000403-49000425 ACAAAGCAGGTAGTAGTAGTAGG - Intronic
1127475355 15:59327649-59327671 ACAGTGCAGGAGGGTATAGTGGG + Intronic
1127681553 15:61303086-61303108 ACAGAGCTGGGGGTGGGGGTAGG - Intergenic
1127872028 15:63081748-63081770 ACAGACCAGGGGCTTGTGGAGGG - Intergenic
1127879598 15:63145023-63145045 ACAGAGCAGCGGATGGAAGTTGG - Intronic
1129862430 15:78872956-78872978 AGAGAGTAGGGGGCGGTAGTCGG + Exonic
1132318723 15:100909593-100909615 ACAGTGGAGGGGTTTGCAGTGGG - Intronic
1134512862 16:14862769-14862791 ACAGAACAGGGGCCCGTAGTGGG - Intronic
1134700499 16:16261258-16261280 ACAGAACAGGGGCCCGTAGTGGG - Intronic
1134971327 16:18533401-18533423 ACAGAACAGGGGCCCGTAGTGGG + Intronic
1135008499 16:18850900-18850922 AAACAGCAGGGCGTGGTAGTGGG - Intronic
1136527008 16:30837736-30837758 AGAGGGCAGGGGGTGGTAGCAGG + Intronic
1139916041 16:70429033-70429055 ACAGAGCAGGAGTTGGAAGTGGG + Intronic
1141377774 16:83547835-83547857 AGTGAGGAGGGTGTTGTAGTGGG + Intronic
1141673859 16:85507308-85507330 ACTGAGCGGGGGGCTGTGGTAGG + Intergenic
1142234809 16:88916998-88917020 AGGGAGGTGGGGGTTGTAGTGGG + Intronic
1146784006 17:35702757-35702779 AGACAGCAGGAGGTTGTATTTGG + Intronic
1148587140 17:48788918-48788940 GGAGTGCAGGGGGCTGTAGTGGG + Intronic
1148664299 17:49362594-49362616 AGAGTGCAGGGGGTTGTAGCAGG + Intergenic
1148740893 17:49891586-49891608 ACAGAGCACGAGGTTGGAGTGGG + Intergenic
1148864495 17:50621452-50621474 TCAGAGCAGGGGGTTGAAGTGGG + Intronic
1150490078 17:65568367-65568389 GCAGAGCAGGAGGTGGTGGTGGG - Intronic
1151757192 17:76081735-76081757 ACTGAGCAGTGGGTTGCAGGAGG - Exonic
1152141574 17:78540321-78540343 ACAGAGCAGGGGCTGGTGGGTGG + Intronic
1152284135 17:79402746-79402768 TCAGAGCACGGGTTTGGAGTTGG + Intronic
1159921388 18:74230309-74230331 ACAGTGCATGGGGTTGAAGCTGG - Intergenic
1160240122 18:77117728-77117750 TCTGAGCAGTGGGTTGGAGTGGG + Intronic
1161048270 19:2148665-2148687 ACAGAGCAGGGGGCTCTAGATGG + Intronic
1161205156 19:3036894-3036916 TCAGAGCTGGGGGTGGGAGTGGG + Intronic
1161237113 19:3203752-3203774 AAAGAACAGGAGGTTGTAGCTGG - Exonic
1161470722 19:4455691-4455713 ACAGTGCAGGGGCCTGCAGTGGG - Intronic
1165113348 19:33514546-33514568 ACAGTGCAGGGGGGTGTATCTGG - Intronic
1166275310 19:41749578-41749600 GCAGAGCAGGGGCGTGTTGTAGG - Intronic
1166280334 19:41788375-41788397 GCAGAGCAGGGGCGTGTTGTAGG - Intergenic
1166373212 19:42313684-42313706 CCAGACCTGGGGGTTGTAGGAGG + Intronic
1166396408 19:42444369-42444391 GCAGAGCAGGGGCGTGTTGTAGG + Intergenic
1167078681 19:47264741-47264763 GCAGAGCAGGGGGTTGGCGCGGG - Intronic
925230038 2:2225283-2225305 CCAGGGCAGGGGGTTGTAGTTGG + Intronic
926543582 2:14210621-14210643 ACAGAGCAGTGGGGGGTATTTGG - Intergenic
928979986 2:37127594-37127616 ACAGAGCAGTGGGTGCTAGGTGG - Intronic
930088315 2:47514111-47514133 ACAGAGCAGGGCCTTGTTGGGGG - Intronic
934475223 2:94588921-94588943 GGAGAGCAGGGGGCTGGAGTGGG - Intronic
934478022 2:94605767-94605789 ACAGAGCAGGGTATTGTGGTGGG + Intergenic
938317508 2:130340276-130340298 ACAGAGCAGAGGGAGGAAGTAGG - Intronic
939242662 2:139581485-139581507 ACAGAACAAGGGTTTGTAGAGGG - Intergenic
939601462 2:144197062-144197084 ATATAGCATGGGGGTGTAGTAGG - Intronic
939904841 2:147899774-147899796 ATAGAGCAGGATGTTGTAATAGG - Exonic
941270051 2:163414227-163414249 ACAGGGAAAGGGGTTGTGGTAGG - Intergenic
947654019 2:231810815-231810837 GCAGCGAAGGGGGTTGCAGTAGG + Intergenic
948100242 2:235367227-235367249 AAAGAGCAGGGGAATGTGGTGGG - Intergenic
1171096070 20:22333280-22333302 ACTGAGCAGAGGCTTGTAGTGGG - Intergenic
1171231434 20:23489845-23489867 ACAGGGCAGGGGGTTACTGTTGG + Intergenic
1171411517 20:24951349-24951371 ACAGAGCAGGGGGCTGAGGCTGG - Intronic
1173997247 20:47347882-47347904 ACAGAACAGGAGGTGGTAGAGGG - Exonic
1174113984 20:48214529-48214551 ACAGAGCAGGGGGAGGTTGGGGG - Intergenic
1176783978 21:13232676-13232698 ACAGAATAGGGGGTTGTGGCAGG + Intergenic
1177982026 21:27926509-27926531 ACAGAATAGGGGGTTGTGGCAGG + Intergenic
1178239444 21:30881947-30881969 ACAGGGCATGGGCTTGTAATTGG - Intergenic
1178376326 21:32070610-32070632 TCAAAGCTGGGGGTTGTTGTAGG - Intergenic
1178419690 21:32433686-32433708 ACAGAGCAGGGCACTGTTGTGGG + Intronic
1180934976 22:19619517-19619539 ACAGAGCAGGTGGAGGAAGTGGG - Intergenic
1183332425 22:37228712-37228734 ACAGAGCTGGGGGGAGAAGTCGG + Intronic
1184419539 22:44371671-44371693 CCAGAGCTGGGGGCTGTAGCAGG - Intergenic
1184451308 22:44584347-44584369 ATAGAGCAGGGGGTTGGAAATGG - Intergenic
950331359 3:12158657-12158679 CCACAGCAGGGGGTGGTTGTGGG - Intronic
950485176 3:13269120-13269142 GCAGTGCAGGGGGTTGGGGTAGG + Intergenic
951178443 3:19629833-19629855 ACAGAGAAGGGTGTTGAAGTTGG - Intergenic
951318385 3:21214715-21214737 AAAGAGCAGATGGTTGTAGGTGG + Intergenic
952222879 3:31342225-31342247 ACTGAGGAGGGGGTGGCAGTGGG + Intergenic
952607293 3:35164487-35164509 ACAGAGCAGGGGGTCATAGATGG + Intergenic
953794816 3:45976492-45976514 AGAGAGCAGGTGCTTGTGGTAGG - Intronic
954136592 3:48584781-48584803 ACAGAGCAGAGGGTGGTGCTTGG + Intronic
954619845 3:51989292-51989314 ACAGAGCAGTGTGGGGTAGTGGG - Intergenic
956670172 3:71681654-71681676 ACAGAGCTGGGTATTGAAGTCGG - Exonic
957974076 3:87420741-87420763 ACTGATCATGGGGTTGTAGTTGG + Intergenic
960232593 3:115245570-115245592 ACAGAGTTGGTGGTGGTAGTTGG + Intergenic
961884270 3:130085705-130085727 ACAGAGCAGGGCACTGTTGTGGG - Intronic
962563812 3:136636303-136636325 ACAACGCAGGTGGTGGTAGTGGG + Intronic
967575301 3:191082906-191082928 AGAGAGCAGGGGGTGGGAGGAGG + Intergenic
968221631 3:196944203-196944225 AGAGAGCAGGGGGTTGGGGGTGG - Intergenic
968660518 4:1796940-1796962 ACACAGCAGAGGGCTGTCGTTGG + Intronic
970598298 4:17619643-17619665 ACAGGGAAGGGGCATGTAGTAGG + Intronic
972766056 4:42152700-42152722 ACAGAGGAGGGGCTAGTCGTTGG + Exonic
975054083 4:69905949-69905971 TCATAGTAGGGGGTTGTAGGAGG + Intergenic
975190199 4:71451680-71451702 ACAGACCAGGTGGGTGTGGTGGG + Intronic
977393031 4:96437443-96437465 ACAGGGTAGGGGGTTGGAGGTGG + Intergenic
978355590 4:107869228-107869250 ACATACCAGGGAGTTGTAGCAGG + Intronic
980082390 4:128357881-128357903 AAAGAGCAGAGGGTTCTAGTAGG - Intergenic
980213076 4:129814632-129814654 ACAGAGCAAGTGGCTTTAGTGGG - Intergenic
982309773 4:153972683-153972705 TCAGAGTAGGGAGTTGTAATTGG + Intergenic
984081206 4:175252279-175252301 ACACAGGATGGGGATGTAGTGGG - Intergenic
985484653 5:141223-141245 ACAGTGCAGGGGGAGGTTGTGGG - Intronic
985695096 5:1335639-1335661 ACAGAGCAGGGGGTGGCCGTGGG + Intronic
986895779 5:12366016-12366038 ACATAGCCTGGGTTTGTAGTAGG - Intergenic
987736849 5:21857192-21857214 TAAGAGCAGGAGGTTGTGGTTGG + Intronic
992199828 5:74372095-74372117 AGAAAGCAGGGGGTGGGAGTGGG - Intergenic
992946371 5:81814806-81814828 ACAGAGGAGGGGTTTGAAGAAGG + Intergenic
996953764 5:129159177-129159199 AAAGAGCAGATGGTTGTAGGTGG + Intergenic
997269900 5:132527678-132527700 ACAGTGCAGGGCATTGTAGTGGG - Intergenic
997696105 5:135862325-135862347 ACATAACAGGAGGTTGGAGTTGG + Intronic
998129312 5:139643340-139643362 GCAGAGTAGGGGGTGGTAGCTGG + Intergenic
1001057606 5:168462358-168462380 ACAGAAGAGGGGGTTGGGGTGGG - Intronic
1001603348 5:172943387-172943409 GCAGAGGTGGGGGGTGTAGTCGG - Intronic
1001709411 5:173766054-173766076 ACTGAGGAGGGGGTTTGAGTAGG + Intergenic
1002424093 5:179165641-179165663 CCAGAGCAGGGGGCGGTAGATGG + Intronic
1003532173 6:6946833-6946855 ATACAGCAGTGTGTTGTAGTGGG + Intergenic
1004923093 6:20395212-20395234 TGAGAGCAGGGGGCTGTGGTAGG + Intergenic
1005082353 6:21969378-21969400 ACTGAGAAGGGGGTAGTGGTTGG - Intergenic
1007229559 6:40338805-40338827 GCAGAGCAGGAGGTGGTAGATGG - Intergenic
1008482930 6:52005611-52005633 ACAGAGTAGGGGCTCGGAGTTGG - Intronic
1009398211 6:63227495-63227517 ACGGAGCAGTGGGTTCTGGTGGG + Intergenic
1012137064 6:95571696-95571718 ACATAGTAGGTGCTTGTAGTAGG - Intergenic
1012221626 6:96656635-96656657 AGAGAGCAGGGGGTAGAAATGGG + Intergenic
1012290764 6:97452911-97452933 ACAGAGCAGGGAGTTGTCCAAGG + Intergenic
1012426491 6:99120921-99120943 ACAGAGCAGTGGATTGTTCTGGG + Intergenic
1012874410 6:104709521-104709543 AGCAAGCAGGGGGTTGGAGTTGG - Intergenic
1013350143 6:109298261-109298283 ACAGGGCAGAGGGTTGTTGCAGG - Intergenic
1013884143 6:114941311-114941333 ACAGAGCAGCAGGGTGTAATTGG - Intergenic
1015184639 6:130400844-130400866 ACAAAGCAGGGGGTTGGACTTGG - Intronic
1015672823 6:135709544-135709566 ACAGTGCAGGTGGCTGTAGGAGG + Intergenic
1015683450 6:135833510-135833532 GGAGAGCAGGGGTTGGTAGTGGG - Intergenic
1016890714 6:149004443-149004465 ACAGAACAGAGAGTGGTAGTGGG + Intronic
1016997136 6:149968571-149968593 ACACAGGAGGGGGTTGGTGTGGG - Intronic
1018641310 6:165907048-165907070 ACAGAGCAGGGCCTTGTGTTAGG + Intronic
1019781105 7:2940247-2940269 TCAGAGAAGGGCGTTGAAGTGGG - Intronic
1022835363 7:34108530-34108552 ACAGAGCATGTGGTTGCTGTTGG + Intronic
1023149333 7:37185471-37185493 TCTGGGCAGGGGCTTGTAGTGGG + Intronic
1024566072 7:50682004-50682026 ACAGAGCAGGAGATGGTAGGGGG + Intronic
1025010735 7:55395923-55395945 ACAGAGCACAGGGGTGTAGTTGG - Intronic
1025815279 7:64905063-64905085 AAAGAGCAGGTGGATGTCGTGGG + Intronic
1026152890 7:67803148-67803170 ACAGAGCATGGGGTTGGAGAAGG - Intergenic
1028306372 7:89270359-89270381 AAAGAGCAGATGGTTGTAGATGG + Intronic
1029017095 7:97326019-97326041 ACAGAATAGGGGGGTGTGGTAGG + Intergenic
1031972482 7:128074635-128074657 AGACAGCAGGGACTTGTAGTAGG - Exonic
1032652743 7:133896513-133896535 AAAGAGAAAGGGGTTGTAGTCGG + Intronic
1033633459 7:143184637-143184659 ACAGAGCAAGGGGAGGTAGAGGG - Intergenic
1034370360 7:150590023-150590045 AAAGACCAGATGGTTGTAGTTGG + Intergenic
1034398573 7:150846465-150846487 ACAGAGCAGGGGCATGTGGTGGG - Intronic
1034667829 7:152833446-152833468 AAAGAGCAGGGGCTTCTAATAGG + Intronic
1035341164 7:158163102-158163124 GCAGAGCAGGGGGCTGTAGTGGG + Intronic
1035421229 7:158730253-158730275 ACAGAGGACGGGGATGCAGTGGG + Intergenic
1039957890 8:42221328-42221350 TCTGAGCAGGGGGTTGGAATGGG + Intergenic
1041260795 8:56019151-56019173 ACAGAGGAGGGGGTGGGAATGGG + Intergenic
1041723575 8:60998178-60998200 ACAGTGCTGGGGCTGGTAGTTGG + Intergenic
1043299750 8:78712869-78712891 ACTGAGCAGACTGTTGTAGTAGG - Intronic
1045053808 8:98351610-98351632 ACAGAGCTGGGGGCTGCAGAGGG + Intergenic
1045960687 8:107964640-107964662 ACAGAGCAGGGGGTTGTAGTTGG - Intronic
1046547779 8:115673353-115673375 ACGGAGCAGGGGGTAGAAATAGG - Intronic
1046961508 8:120117952-120117974 CCAGAGCAAGGGGATGTACTAGG + Intronic
1049595977 8:143483557-143483579 ACAGAGCAGAGGCGTGCAGTGGG + Intronic
1050179865 9:2909867-2909889 ACAGAGCAGGTGGGTTAAGTGGG + Intergenic
1050646533 9:7725530-7725552 GCATAACAGGGGGTTTTAGTAGG + Intergenic
1050772055 9:9214509-9214531 ACAAAGCAGGGGGTGGGAGAGGG + Intronic
1050808819 9:9718627-9718649 ACAGAGCAGGTGCTTGGAGCAGG - Intronic
1051533325 9:18129787-18129809 TCAGAGCATAGGGTTGTATTTGG + Intergenic
1052851927 9:33383793-33383815 ACAGAGCAGGGTATGGTGGTGGG - Intergenic
1052854830 9:33400851-33400873 GGAGAGCAGGGGGCTGGAGTGGG + Intronic
1053148884 9:35730493-35730515 ACACAGCAGGGGATGGGAGTAGG + Intronic
1053680034 9:40480341-40480363 ACAGAGCAGGGTATTGTGGTGGG - Intergenic
1053682848 9:40497170-40497192 GGAGAGCAGGGGGCTGGAGTGGG + Intergenic
1053930026 9:43108651-43108673 ACAGAGCAGGGTATTGTGGTGGG - Intergenic
1053932830 9:43125484-43125506 GGAGAGCAGGGGGCTGGAGTGGG + Intergenic
1054280866 9:63127758-63127780 GGAGAGCAGGGGGCTGGAGTGGG - Intergenic
1054283678 9:63144594-63144616 ACAGAGCAGGGTATTGTGGTGGG + Intergenic
1054293115 9:63315851-63315873 ACAGAGCAGGGTATTGTGGTGGG - Intergenic
1054295948 9:63332670-63332692 GGAGAGCAGGGGGCTGGAGTGGG + Intergenic
1054391141 9:64620344-64620366 ACAGAGCAGGGTATTGTGGTGGG - Intergenic
1054393964 9:64637165-64637187 GGAGAGCAGGGGGCTGGAGTGGG + Intergenic
1054428613 9:65142377-65142399 GGAGAGCAGGGGGCTGGAGTGGG + Intergenic
1054501766 9:65879165-65879187 GGAGAGCAGGGGGCTGGAGTGGG - Intronic
1054504587 9:65895983-65896005 ACAGAGCAGGGTATTGTGGTGGG + Intergenic
1054733731 9:68728809-68728831 ACAGGGCAGGAGGTTCTCGTTGG - Intronic
1055936675 9:81610584-81610606 ACAGAGCAGTATGTTGTATTAGG + Intronic
1056627416 9:88265018-88265040 ACAGAGCATGGGGCTGCAGCAGG - Intergenic
1056752585 9:89363119-89363141 ACAGAGAATGGGGTGGTCGTGGG + Intronic
1057171630 9:92966486-92966508 ACAGAGCAGGGGGTCCTGGAGGG - Intronic
1062107037 9:134761315-134761337 ACAGAGCAGTGGGGTGTGGGTGG - Intronic
1187466469 X:19532144-19532166 ACAGAACAAGGTGATGTAGTAGG - Intergenic
1188165090 X:26852600-26852622 ACAGAGAAGGAGATTATAGTGGG - Intergenic
1189045867 X:37590160-37590182 TCAGAATAGGGGGTTGGAGTGGG - Intronic
1190333610 X:49250029-49250051 ACAGAGCAGGCTGTTGGAGTTGG + Intronic
1192612331 X:72579434-72579456 ATAAAGGAGGGGGTTGAAGTAGG + Exonic
1195081459 X:101375450-101375472 ACAGAGCTGGGGGCTGTGGGAGG - Intronic
1196200910 X:112884893-112884915 AAAAAGCTGGGGGTGGTAGTGGG - Intergenic
1197767726 X:130069929-130069951 CCAAAGCAGGGGGTTGGAGTGGG - Intronic
1198200098 X:134407891-134407913 ACAGAGCAGGTGGAAGTAGAAGG + Intronic
1201255411 Y:12103369-12103391 ACTGAGCTGGGGGTGGTGGTGGG + Intergenic