ID: 1045960688

View in Genome Browser
Species Human (GRCh38)
Location 8:107964650-107964672
Sequence AAATGGCTGAACAGAGCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 355}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045960688_1045960697 8 Left 1045960688 8:107964650-107964672 CCCCCTGCTCTGTTCAGCCATTT 0: 1
1: 0
2: 1
3: 25
4: 355
Right 1045960697 8:107964681-107964703 GGTAACTCTTCTGCTTTGCAGGG No data
1045960688_1045960704 17 Left 1045960688 8:107964650-107964672 CCCCCTGCTCTGTTCAGCCATTT 0: 1
1: 0
2: 1
3: 25
4: 355
Right 1045960704 8:107964690-107964712 TCTGCTTTGCAGGGGGTGGGGGG No data
1045960688_1045960698 9 Left 1045960688 8:107964650-107964672 CCCCCTGCTCTGTTCAGCCATTT 0: 1
1: 0
2: 1
3: 25
4: 355
Right 1045960698 8:107964682-107964704 GTAACTCTTCTGCTTTGCAGGGG No data
1045960688_1045960701 14 Left 1045960688 8:107964650-107964672 CCCCCTGCTCTGTTCAGCCATTT 0: 1
1: 0
2: 1
3: 25
4: 355
Right 1045960701 8:107964687-107964709 TCTTCTGCTTTGCAGGGGGTGGG No data
1045960688_1045960700 13 Left 1045960688 8:107964650-107964672 CCCCCTGCTCTGTTCAGCCATTT 0: 1
1: 0
2: 1
3: 25
4: 355
Right 1045960700 8:107964686-107964708 CTCTTCTGCTTTGCAGGGGGTGG No data
1045960688_1045960696 7 Left 1045960688 8:107964650-107964672 CCCCCTGCTCTGTTCAGCCATTT 0: 1
1: 0
2: 1
3: 25
4: 355
Right 1045960696 8:107964680-107964702 AGGTAACTCTTCTGCTTTGCAGG No data
1045960688_1045960703 16 Left 1045960688 8:107964650-107964672 CCCCCTGCTCTGTTCAGCCATTT 0: 1
1: 0
2: 1
3: 25
4: 355
Right 1045960703 8:107964689-107964711 TTCTGCTTTGCAGGGGGTGGGGG No data
1045960688_1045960699 10 Left 1045960688 8:107964650-107964672 CCCCCTGCTCTGTTCAGCCATTT 0: 1
1: 0
2: 1
3: 25
4: 355
Right 1045960699 8:107964683-107964705 TAACTCTTCTGCTTTGCAGGGGG No data
1045960688_1045960702 15 Left 1045960688 8:107964650-107964672 CCCCCTGCTCTGTTCAGCCATTT 0: 1
1: 0
2: 1
3: 25
4: 355
Right 1045960702 8:107964688-107964710 CTTCTGCTTTGCAGGGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045960688 Original CRISPR AAATGGCTGAACAGAGCAGG GGG (reversed) Intronic
900000532 1:12547-12569 AAATGGTAGAACGGAGCAGCTGG + Intergenic
900020245 1:183066-183088 AAATGGTAGAACGGAGCAGCTGG + Intergenic
900852262 1:5153462-5153484 CAAAGACTGCACAGAGCAGGGGG - Intergenic
901277392 1:8002853-8002875 AAATTGCTGAACCCAGGAGGCGG - Intergenic
902274407 1:15328876-15328898 ACATGGCTTATCAGAGCAGGCGG + Intronic
902332232 1:15736267-15736289 GAACAGCTGAGCAGAGCAGGTGG + Intergenic
902843200 1:19088644-19088666 AGAAGGCTGGACAGAGTAGGAGG - Intronic
904840170 1:33367516-33367538 GAATGGCTGAATAGAACAGGAGG + Intronic
905768143 1:40620277-40620299 AAATGCCTGAGCAGAGCTGCTGG + Intergenic
907196955 1:52694860-52694882 ACATGGCTGAACCAAGGAGGAGG + Intronic
907749211 1:57246267-57246289 CCAAGGCTGCACAGAGCAGGGGG - Intronic
911086116 1:93978714-93978736 ATATGGTTGACCAGAGCAGAGGG - Intergenic
912052091 1:105542074-105542096 CCAAGGCTGCACAGAGCAGGAGG + Intergenic
912113511 1:106373018-106373040 CCAAGGCTGAACAGAGCAGAAGG + Intergenic
912363801 1:109116396-109116418 AAGAAGCTGAACAGAGAAGGAGG - Intronic
913018520 1:114763936-114763958 CCAAGGCTGCACAGAGCAGGGGG - Intergenic
913073378 1:115320786-115320808 AAATGGCTCTACAAAGCAGAAGG + Intronic
915496170 1:156284260-156284282 ACCTGTCTGACCAGAGCAGGTGG - Exonic
916007351 1:160674554-160674576 AAAGGGCTGGGCAGAGCAGCTGG + Intergenic
916072717 1:161180228-161180250 AATTGGCTGAACCCAGGAGGCGG - Intergenic
917019527 1:170570540-170570562 CAATAGCTGAACTGATCAGGTGG + Intergenic
917567310 1:176226072-176226094 CAATGGCTGAACAGTGCACTTGG + Intergenic
917863135 1:179167382-179167404 AGATGGCTGAAAAGAGTGGGAGG + Intronic
918166016 1:181948588-181948610 CAAAGGCTGCATAGAGCAGGGGG - Intergenic
918245612 1:182656872-182656894 AAGTGGGTGAGCAGAGGAGGAGG - Intronic
919155018 1:193753318-193753340 AAGTGGCCAAACAGATCAGGAGG + Intergenic
919785266 1:201254643-201254665 GAGTGGGTGAACAGAGCTGGAGG + Intergenic
920610545 1:207432626-207432648 CAATGGTTGAAAACAGCAGGTGG + Intergenic
920856760 1:209669094-209669116 AAATCACTGAAGAGAGCATGTGG + Intergenic
921059356 1:211569834-211569856 AAAAGGCTGAATAGAGTAGTGGG + Intergenic
922386958 1:225096051-225096073 AAATGCCTGAACCCAGGAGGTGG - Intronic
923062845 1:230491588-230491610 AACTAGGTGAACAGAGGAGGAGG - Intergenic
923088718 1:230722075-230722097 CAGAGGCTGCACAGAGCAGGCGG - Intergenic
923223059 1:231913865-231913887 AAATGGCTGAGGAGAGGAGATGG - Intronic
923467978 1:234265948-234265970 AAAGGCCTGAACAGAGTAAGAGG - Intronic
924642141 1:245844208-245844230 AAATGGCTGATGAGAACTGGAGG - Intronic
1063069402 10:2646109-2646131 AAAAGGGGAAACAGAGCAGGAGG - Intergenic
1064437069 10:15319723-15319745 AAATCCCTGGACAGACCAGGCGG - Intronic
1064656751 10:17563881-17563903 AATGGGCTGAGCAGAGGAGGTGG - Intergenic
1065540329 10:26759296-26759318 AGATGGCAGAACAAAGCAGGAGG + Intronic
1066092668 10:32040899-32040921 AATTGCCTGAACCGGGCAGGTGG + Intronic
1071923297 10:90375805-90375827 AGATGGATGAACAGAACATGAGG - Intergenic
1072524514 10:96259460-96259482 GGGTGGCTGAACAGAGCAGCTGG + Intronic
1072792232 10:98326745-98326767 AAATGGCAGAACACAGCAGAGGG + Intergenic
1073522844 10:104150640-104150662 AGATGTCTGACCAAAGCAGGGGG - Intronic
1074305533 10:112274731-112274753 AAATGTCTGCCCAGGGCAGGAGG + Intergenic
1076220123 10:128727217-128727239 CAATGGCTGCAATGAGCAGGTGG - Intergenic
1076561711 10:131370872-131370894 AAATGGGACAACACAGCAGGAGG + Intergenic
1077695042 11:4386049-4386071 AGATGGCAGGTCAGAGCAGGGGG - Intronic
1078235776 11:9483382-9483404 AACTGCTTGAACTGAGCAGGTGG - Intronic
1081016800 11:37892000-37892022 CTAAGGTTGAACAGAGCAGGGGG + Intergenic
1082073894 11:47961647-47961669 AAAGGCCTGCTCAGAGCAGGCGG - Intergenic
1082877588 11:58003567-58003589 ATAGGGGTGGACAGAGCAGGGGG + Intergenic
1083007794 11:59364845-59364867 TGATGGATGAATAGAGCAGGGGG - Exonic
1084551726 11:69847512-69847534 AAGGGGTTGAGCAGAGCAGGGGG + Intergenic
1085264049 11:75225912-75225934 AAATGGAAGAAGAGAGCAGGAGG - Intergenic
1086272693 11:85087028-85087050 AAATGAATGAACAGAGCAATAGG - Intronic
1086787192 11:90983395-90983417 CAATTGCTGAACATAGCATGTGG - Intergenic
1087354162 11:97073430-97073452 CAATAGCAGAACAGAGCAAGTGG - Intergenic
1088697185 11:112377993-112378015 AAATTGCTGAACCCAGGAGGTGG + Intergenic
1090952745 11:131487879-131487901 AAATGCCTGAACAAAGAAAGTGG - Intronic
1091373617 12:12674-12696 AAATGGTAGAACGGAGCAGCTGG + Intergenic
1091398768 12:170451-170473 AGAGGGCTGAGCACAGCAGGGGG + Intronic
1091635638 12:2194417-2194439 ATATGGCTGCTCAGAGGAGGGGG - Intronic
1091906782 12:4195523-4195545 AAATGGAGGAACAGACAAGGAGG - Intergenic
1092246290 12:6866224-6866246 GAATGGCTGGGCAGAGCAGAGGG + Exonic
1092318222 12:7441624-7441646 AAATGAATGAACAAAGTAGGGGG - Intronic
1094397640 12:30025145-30025167 ACAAGGCTGCAAAGAGCAGGGGG + Intergenic
1094607591 12:31962129-31962151 AAGTGGCTGAACCCAGGAGGTGG + Intronic
1094673228 12:32591704-32591726 AAAGGTCTGAACAGAGCTGCAGG + Intronic
1094831733 12:34303385-34303407 AAATGGCGCAGCAGAGGAGGGGG + Intergenic
1094836386 12:34324086-34324108 AAATGGCGCAGCAGAGGAGGGGG - Intergenic
1095836836 12:46648338-46648360 CCAAGGCTGCACAGAGCAGGGGG + Intergenic
1096955946 12:55526302-55526324 AGAAGTCTGGACAGAGCAGGTGG + Intergenic
1097020791 12:56019596-56019618 AATAGGCTTAACTGAGCAGGAGG - Intronic
1097098040 12:56565642-56565664 AGGAGGCTGAGCAGAGCAGGTGG + Intronic
1098838332 12:75448089-75448111 ACATGGCTACAGAGAGCAGGTGG + Intergenic
1099685009 12:85874126-85874148 AAATGGGGGAGGAGAGCAGGGGG + Intergenic
1100937937 12:99691164-99691186 CCAAGGCTGCACAGAGCAGGAGG + Intronic
1101565664 12:105902616-105902638 ACAAGGATGAACACAGCAGGTGG - Intergenic
1102691735 12:114766651-114766673 GAATGGCTGAACCCAGGAGGCGG - Intergenic
1104190813 12:126480220-126480242 AAAAGCCTGCACAGAGGAGGTGG + Intergenic
1104239222 12:126971240-126971262 AAATTGATGCACAGAGAAGGTGG - Intergenic
1104587923 12:130062510-130062532 CCAAGGCTGCACAGAGCAGGGGG - Intergenic
1105216750 13:18291415-18291437 AAATCCAAGAACAGAGCAGGTGG + Intergenic
1105694102 13:22871438-22871460 TAAAGGCTGCACACAGCAGGCGG - Intergenic
1106714549 13:32374133-32374155 CCATGGCTGCACAGAGCAGTGGG + Intronic
1107161730 13:37238388-37238410 AAATGGGTAAAAACAGCAGGGGG + Intergenic
1109963073 13:69657698-69657720 AAATGCTTGAACCGAGGAGGTGG - Intergenic
1110799295 13:79676252-79676274 AAATACCTGAAAGGAGCAGGAGG - Intergenic
1112021195 13:95372620-95372642 AATTGGCTGAACAAAGCAGATGG - Intergenic
1112360732 13:98715596-98715618 AAATGGCAGAACAGTGCTTGAGG - Intronic
1112372499 13:98806462-98806484 AAATGGCTGTGCAGAGCACATGG + Intronic
1112514404 13:100039558-100039580 AAATGGAAAAACAGAACAGGTGG - Intergenic
1113432362 13:110261922-110261944 CAGTGGCTGCACAGGGCAGGTGG + Intronic
1114769400 14:25411266-25411288 AAATGGGTGAACTGAGCCTGTGG + Intergenic
1115949549 14:38704795-38704817 AAATGGATAATCAGAGCATGAGG - Intergenic
1116441649 14:44961742-44961764 AAAGGACTGAGCGGAGCAGGTGG - Intronic
1117046353 14:51816996-51817018 ATATGGCTGAACTACGCAGGTGG - Intergenic
1117201370 14:53393378-53393400 GAATGGCTGAACCCAGGAGGTGG + Intergenic
1117742891 14:58836115-58836137 AATTGCCTGAACCGAGGAGGCGG - Intergenic
1117858530 14:60062854-60062876 ACATGGCTGATTAAAGCAGGAGG - Intronic
1118723588 14:68610692-68610714 AAATGGATGTAAAGAACAGGAGG - Intronic
1119256350 14:73201173-73201195 GAATGGCTGAACCCAGGAGGCGG - Intronic
1119305817 14:73607400-73607422 ACAAGGCTGCACACAGCAGGAGG + Intergenic
1119549258 14:75496565-75496587 AAAAGGCTTCACAGAGGAGGAGG + Intergenic
1119706671 14:76787363-76787385 AAATGGCTAACCACAGCAGAGGG - Exonic
1120816452 14:88864409-88864431 AAAGGGCTGAAATGAGCAGAAGG - Intronic
1120921095 14:89756003-89756025 TCAAGGCTGCACAGAGCAGGAGG + Intergenic
1121223371 14:92303113-92303135 AAACAGTTGAACAGAACAGGGGG - Intergenic
1121369809 14:93346920-93346942 AAAAGGCGGGGCAGAGCAGGGGG + Intronic
1121644766 14:95510266-95510288 AAATGGATTCACAGAGCAGAGGG + Intergenic
1125869033 15:43080862-43080884 AAATGCATGAACACAGGAGGTGG + Intronic
1126961075 15:53995243-53995265 AAAAGTCTGAAAAGAGCAGAGGG + Intergenic
1129268918 15:74409435-74409457 AAATGGATGGACAGGGCTGGGGG + Exonic
1131674475 15:94657332-94657354 AAAGGGCTGATCAAAGCAGGTGG - Intergenic
1132452975 15:101978398-101978420 AAATGGTAGAACGGAGCAGCTGG - Intergenic
1132453918 16:12228-12250 AAATGGTAGAACGGAGCAGCTGG + Intergenic
1132468112 16:86965-86987 ACAGGCCTGAACAGAGCTGGTGG + Intronic
1133390154 16:5403791-5403813 AAATCACTGAATAGAGCAGTGGG - Intergenic
1133679968 16:8112285-8112307 AAATGGCTTAAAAGAGCATCTGG - Intergenic
1134859824 16:17551231-17551253 AATTGCCTGAACCCAGCAGGTGG - Intergenic
1135151712 16:20012750-20012772 ACATGGCTGGAGGGAGCAGGAGG + Intergenic
1135738783 16:24955853-24955875 AAATGGATGGAAAGAGCAAGAGG + Intronic
1136012697 16:27374367-27374389 ACATGGCTGAACAGAGGAGCTGG - Intergenic
1136747482 16:32604495-32604517 AAATGGATGATAAGTGCAGGAGG + Intergenic
1137832129 16:51554019-51554041 AAATAGCTGAACTGAACAAGGGG + Intergenic
1138236458 16:55387351-55387373 ATCTGGCAAAACAGAGCAGGTGG - Intergenic
1139410289 16:66753186-66753208 AATTGGCTGGCCAGGGCAGGAGG - Intergenic
1140171955 16:72614730-72614752 ATATGGGTGAGCAGACCAGGAGG - Intergenic
1140176570 16:72666292-72666314 AAATGGCTCCACAATGCAGGTGG - Intergenic
1141302789 16:82833624-82833646 AGATGGAAGAACAGAGCGGGAGG - Intronic
1141690301 16:85592960-85592982 AGCTGGCTGAACAGAGGTGGCGG - Intergenic
1142141070 16:88473131-88473153 AAAAGGCTGAACTGAGCCAGAGG + Intronic
1203049617 16_KI270728v1_random:863700-863722 AAATGGATGATAAGTGCAGGAGG + Intergenic
1142562614 17:819730-819752 AAATGCCTCCACACAGCAGGTGG + Intronic
1142908768 17:3069129-3069151 GAATGGCTGATCAGAGATGGAGG + Intergenic
1142925799 17:3235116-3235138 GAATGGCTGATCAGAGATGGAGG - Intergenic
1143354366 17:6314581-6314603 AAGTGGCTCAAGAGAGCTGGGGG - Intergenic
1145252255 17:21303020-21303042 AAATGCCAGGACAGGGCAGGAGG + Intronic
1145257175 17:21332384-21332406 GAATGGCTGAACCCAGGAGGCGG - Intergenic
1145319464 17:21755656-21755678 GAATGGCTGAACCCAGGAGGCGG + Intergenic
1146227535 17:31079820-31079842 AAATGTCTGGAGAGAGGAGGGGG - Intergenic
1147433836 17:40393967-40393989 AATTGCCTGAACCTAGCAGGCGG + Intronic
1147564842 17:41529732-41529754 GAATTGTTGAACAGAGCAAGGGG - Intergenic
1149290546 17:55214002-55214024 AAATGACTGTGCAGTGCAGGGGG + Intergenic
1149332026 17:55593758-55593780 GAATGGCTGAACCCAGGAGGCGG - Intergenic
1149445526 17:56710433-56710455 AAATTCCCGGACAGAGCAGGGGG - Intergenic
1150240622 17:63629207-63629229 AATTGCCTGAACACAGGAGGCGG - Intronic
1150627296 17:66849577-66849599 GAATGGCTGAACACAGGTGGGGG + Intronic
1151904155 17:77036705-77036727 ACATGGCTGGAAAGCGCAGGAGG + Intergenic
1151940461 17:77288475-77288497 GAAGGGCTGGGCAGAGCAGGCGG + Intronic
1151945780 17:77319247-77319269 CAAGGGCTCAGCAGAGCAGGTGG - Intronic
1152975767 18:216686-216708 ACATGGCAGAACTGAGCAGAAGG - Intronic
1153440818 18:5117398-5117420 TAAAGGCTGCACAGAGCAGCAGG - Intergenic
1153999387 18:10471143-10471165 AAATGCCTGCACAGGGCAGCAGG + Intronic
1156052429 18:32952858-32952880 GAATGGCTGAACCCAGGAGGCGG - Intronic
1156078391 18:33307708-33307730 CCAAGGCTGCACAGAGCAGGGGG - Intronic
1157030441 18:43900408-43900430 GAATGGCAGAATAGAGCATGAGG + Intergenic
1157304655 18:46508142-46508164 TAATGGCTGAACAGGGGAGGAGG + Intronic
1157947659 18:51998804-51998826 AAATGGCTGAAAAGAGAGGCTGG + Intergenic
1158432089 18:57398550-57398572 AGAAGGCTGAATAGAGGAGGTGG + Intergenic
1158530809 18:58258802-58258824 AAGTTGCTGAATGGAGCAGGCGG - Intronic
1159486835 18:69071910-69071932 AAATTGCTGCACAGAGAAAGAGG - Intergenic
1159889140 18:73938478-73938500 AAACTGCTGAGCAGAGCAGGAGG + Intergenic
1161199139 19:3004935-3004957 AACAGGCTGGACAGAGCTGGGGG - Intronic
1161226691 19:3150262-3150284 ACACGGCTGAATCGAGCAGGTGG - Exonic
1161460824 19:4396310-4396332 AATTGCTTGAACAGAGGAGGCGG + Intronic
1162051291 19:8035324-8035346 AAATGCTTGAACCCAGCAGGCGG - Intronic
1162741033 19:12773862-12773884 AGAGGGCAGAACAGAGCAAGAGG - Intronic
1164049751 19:21574987-21575009 AATTGTCTGAAAAAAGCAGGAGG - Intergenic
1166675228 19:44736898-44736920 GAATAGCTGAACCGAGGAGGCGG - Intergenic
1166734822 19:45077846-45077868 AAAAGGGTGATCAGAGGAGGCGG - Intergenic
1167459362 19:49616120-49616142 AAATGGCTGAAGGAGGCAGGCGG + Exonic
925354380 2:3227730-3227752 CCAAGGCTGCACAGAGCAGGGGG - Intronic
925367543 2:3321046-3321068 ACATATCTGAACAGGGCAGGAGG + Intronic
925575926 2:5360001-5360023 AAATGACTGAATAGATCATGTGG + Intergenic
925584735 2:5453307-5453329 AAGTGGCTGCACAGGCCAGGTGG + Intergenic
925655011 2:6137139-6137161 AAAAGGCTTCACAGAGGAGGTGG + Intergenic
928035243 2:27816683-27816705 GAATGGCTGAACCCAGGAGGCGG - Intronic
928112420 2:28521650-28521672 AAAGGGATGAACAGAGAAAGAGG + Intronic
928865971 2:35918254-35918276 ACATGGCTGGAAAAAGCAGGTGG - Intergenic
929640402 2:43572491-43572513 AAGAGACTGATCAGAGCAGGTGG - Intronic
931863382 2:66381095-66381117 AAATAGCTGAAGAAAGCAAGAGG - Intergenic
932419229 2:71591839-71591861 ACCTGGCTGCACAGAGCTGGAGG - Intronic
932938148 2:76130497-76130519 AAATTTCTGAACATAACAGGAGG - Intergenic
933998987 2:87690848-87690870 AAATGGCTGCAAACAGCATGAGG - Intergenic
934038047 2:88104959-88104981 AGATGGATGAGCAGAGAAGGAGG - Intronic
934054375 2:88239798-88239820 AAGAGGCTGAAGAGAGCAGCTGG + Intergenic
934103234 2:88672843-88672865 AAATGCCTGCACTGAGCAGCTGG + Intergenic
934297577 2:91755263-91755285 AAATCCAAGAACAGAGCAGGTGG - Intergenic
934791442 2:97065505-97065527 AAATGGCTGCAAACAGCATGAGG + Intergenic
935869662 2:107432640-107432662 AAATGGCTTAAAAGAGGTGGTGG - Intergenic
936294857 2:111260035-111260057 AAATGGCTGCAAACAGCATGAGG + Intergenic
936487339 2:112937658-112937680 TAATGGCTGAAAAGAGCATGAGG - Intergenic
936569191 2:113600870-113600892 AAATGGTAGAACGGAGCAGCTGG - Intergenic
939952850 2:148495981-148496003 AAATGTCTGAACATCACAGGAGG - Intronic
942677517 2:178443906-178443928 AAATGGCCTAACAGAGCACATGG + Intronic
943098756 2:183461070-183461092 GAATGGATAAATAGAGCAGGAGG - Intergenic
943579501 2:189668420-189668442 GAATGGCTGAACCCAGGAGGTGG + Intronic
944554231 2:200872161-200872183 AAATTATTGAACAGAGCTGGGGG - Intronic
945336646 2:208600080-208600102 CCAAGGCTGCACAGAGCAGGGGG + Intronic
945456311 2:210056051-210056073 CCAAGGCTGCACAGAGCAGGGGG - Intronic
946156970 2:217813415-217813437 AAATGACTGAAGAGAGAACGTGG + Intronic
947646863 2:231748727-231748749 AAGTGGCTGCACACAGCATGGGG - Intronic
1168971889 20:1936999-1937021 AAATGGGTGAAGACTGCAGGTGG + Intronic
1169441348 20:5636305-5636327 GAATGGCTGAACCCAGGAGGCGG + Intergenic
1170072985 20:12389163-12389185 ACTTGGGTGAACAGAGCAGGTGG - Intergenic
1170602625 20:17852882-17852904 GAATGGCTGAACCCAGAAGGCGG - Intergenic
1171419813 20:25010548-25010570 GAAAGGCTTCACAGAGCAGGAGG - Intronic
1172651404 20:36505072-36505094 AATTGCCTGAACCCAGCAGGCGG - Intronic
1173402879 20:42740442-42740464 CAGGGGCTGCACAGAGCAGGAGG - Intronic
1174443283 20:50573268-50573290 AAGAGGCTGAAAAGAGCAGCTGG - Intronic
1175365649 20:58453603-58453625 AGAGGGCTGAGCAGAGCAGCCGG - Intergenic
1176413348 21:6460851-6460873 CAATGGCTGCAAAGCGCAGGCGG + Intergenic
1177259564 21:18712522-18712544 CCAAGGCTGCACAGAGCAGGGGG - Intergenic
1178085470 21:29107226-29107248 AATTGCCTGAACACAGGAGGCGG + Intronic
1179688845 21:43069174-43069196 CAATGGCTGCAAAGCGCAGGCGG + Intronic
1181490769 22:23259601-23259623 AATTGCCTGAACACAGGAGGGGG - Intronic
1182188008 22:28427564-28427586 GAATCGCTGAACCGAGGAGGCGG + Intronic
1182451601 22:30425161-30425183 AAATGGAGGCACAGAGAAGGTGG - Exonic
1183724486 22:39580933-39580955 ACATGGCTGAACAGGCCTGGGGG - Intronic
1184280999 22:43437463-43437485 AAATGGCAGAACTGGGCAGTGGG + Intronic
1185006205 22:48278320-48278342 AAATACCTGCAGAGAGCAGGAGG + Intergenic
1185138759 22:49088758-49088780 AATTTGCTCAGCAGAGCAGGAGG + Intergenic
950284340 3:11733083-11733105 AAATGCCTGAACCCAGGAGGTGG - Intergenic
951918773 3:27830378-27830400 AAATCGCTGAACCCAGTAGGCGG - Intergenic
953114713 3:39980574-39980596 AAATGTCTGCAAAGATCAGGGGG + Intronic
953331708 3:42058936-42058958 AAATTGCAGCACAGAGCAGATGG - Intronic
954497605 3:50979512-50979534 AGATGGCGCAAGAGAGCAGGAGG - Intronic
957219114 3:77359661-77359683 AAAGGGCTGAATAAAGAAGGTGG - Intronic
957893459 3:86389058-86389080 AAATGGCTGCAGCCAGCAGGGGG - Intergenic
958672209 3:97219595-97219617 ACAGGGCTGCACAGAGCAGCTGG + Intronic
960735536 3:120775426-120775448 AAATAGCTGGACAGAGCGGGAGG + Intronic
960868742 3:122228639-122228661 AAGGGGCTGAACAGGACAGGAGG + Intronic
961605082 3:128087666-128087688 AAATGAGAGAAGAGAGCAGGAGG + Intronic
962066972 3:131991795-131991817 CTAAGGCTGCACAGAGCAGGAGG - Intronic
962646451 3:137445273-137445295 CCAAGGCTGCACAGAGCAGGAGG + Intergenic
964003145 3:151800835-151800857 ATATGGTTGTACAGAGGAGGAGG - Intergenic
964231568 3:154476255-154476277 AAGCAGCTGAACAGAGCAGAAGG - Intergenic
964864979 3:161247700-161247722 AATTGCCTGAACCGAGGAGGTGG + Intronic
965252671 3:166362785-166362807 AACTGTGTAAACAGAGCAGGAGG - Intergenic
966330264 3:178804074-178804096 TAGTGGCTGAACAGAGCTGTGGG - Intronic
966422984 3:179752161-179752183 CAATGGCTGAACTGAAGAGGAGG - Intronic
967106867 3:186261229-186261251 AAATTGCTGAACAGCACAGGTGG - Intronic
968767576 4:2481605-2481627 GAAAGGCAGAAGAGAGCAGGAGG - Intronic
969302443 4:6305009-6305031 AAGGGGCAGACCAGAGCAGGTGG - Intergenic
969683836 4:8657827-8657849 AAATGAATGAACAGGGCCGGTGG - Intergenic
970113602 4:12668156-12668178 AATTGCCTGAACCGAGGAGGCGG - Intergenic
970758166 4:19451094-19451116 ACATGGCTGCACAGAGCAGGGGG + Intergenic
971774628 4:30946792-30946814 AAATGCTTGAACACAGGAGGTGG - Intronic
973919485 4:55670459-55670481 AAATGACTGAACCCAGCAGGAGG - Intergenic
974311005 4:60209809-60209831 CCAAGGCTGCACAGAGCAGGTGG + Intergenic
974742277 4:66022022-66022044 CCAAGGCTGCACAGAGCAGGTGG + Intergenic
974923484 4:68270393-68270415 CCAAGGCTGCACAGAGCAGGGGG + Intergenic
977313743 4:95418883-95418905 GAAGGGCAGAACAGAGGAGGAGG - Intronic
978234968 4:106446965-106446987 CCAAGGCTGCACAGAGCAGGGGG + Intergenic
979125650 4:116968956-116968978 ATGAGGCTGCACAGAGCAGGGGG + Intergenic
979998557 4:127462923-127462945 CAATAGCTGAACAGATCAAGCGG - Intergenic
980791976 4:137632161-137632183 CAGTGGCAGCACAGAGCAGGGGG - Intergenic
982837600 4:160141345-160141367 AAAACTCTGCACAGAGCAGGTGG - Intergenic
983369588 4:166841750-166841772 TATAGGCTGTACAGAGCAGGAGG - Intronic
984069508 4:175093911-175093933 AGATGGCTGCACAGAGATGGCGG + Intergenic
984774766 4:183471874-183471896 AATTGCCTGAACCCAGCAGGCGG + Intergenic
985728146 5:1526365-1526387 CAAGGGCTGTGCAGAGCAGGGGG + Intergenic
987454012 5:18120568-18120590 CAATGGCTGAATAGACCAAGTGG + Intergenic
988744590 5:34121876-34121898 AAATGGCGGAACAGCTCAGGGGG - Intronic
988925084 5:35981904-35981926 CCAAGGCTGAACAGAGCAGTGGG - Intronic
990587518 5:57226644-57226666 AACTGCCTGAACCCAGCAGGCGG - Intronic
991180748 5:63747865-63747887 AAATGGGTGAGGAGAGGAGGTGG - Intergenic
994654677 5:102576622-102576644 ATATGGGTGAAGATAGCAGGTGG - Intergenic
995263651 5:110134806-110134828 CAATGGCTGAATTGAGCAAGAGG - Intergenic
996292249 5:121866106-121866128 ACAGGGCTCCACAGAGCAGGGGG - Intergenic
996356481 5:122601073-122601095 CCAAGGCTGCACAGAGCAGGGGG + Intergenic
997327852 5:133036823-133036845 AATTGCCTGAACCCAGCAGGCGG + Intergenic
997364722 5:133318636-133318658 AAATTGATGTACACAGCAGGTGG + Intronic
998042892 5:138964382-138964404 AAATGGAGGAGCTGAGCAGGAGG + Intronic
998521772 5:142807623-142807645 AAAAGGGTGAAGAGGGCAGGGGG - Intronic
999217170 5:149944953-149944975 AGATGTCTGCACAGAGCAGGAGG + Intergenic
1001687818 5:173608086-173608108 AAATGGCAGCACAATGCAGGGGG + Exonic
1001829580 5:174774229-174774251 AATTTGCAGAACAGAGAAGGTGG - Intergenic
1003523875 6:6882505-6882527 AAAAGGAGGAAAAGAGCAGGAGG - Intergenic
1003679035 6:8233825-8233847 AATTGCCTGAACTCAGCAGGCGG + Intergenic
1003852031 6:10234523-10234545 AAATGGCTGAACAGAAGCAGAGG + Intergenic
1004018996 6:11759365-11759387 GAATGGCTGGTCAGAGAAGGAGG - Intronic
1004310798 6:14543148-14543170 AAAGTGCTTAACACAGCAGGTGG - Intergenic
1005731702 6:28703587-28703609 AAATGGCTGTACACTGCAGCTGG + Intergenic
1005998175 6:30944590-30944612 AAATGAGTGAACAAAGCAGATGG + Intronic
1006303735 6:33207299-33207321 AAGGGGCTGGAGAGAGCAGGAGG + Intergenic
1006586841 6:35120604-35120626 AAATGGCTGACCCAAGCAGCAGG - Exonic
1006683803 6:35815539-35815561 AAATGCCTGATCTCAGCAGGTGG + Intronic
1006787872 6:36679964-36679986 ACAGGGCTGAGCGGAGCAGGGGG + Intronic
1006981723 6:38153141-38153163 GAATGGCAGACCAGAGCCGGCGG - Exonic
1007345032 6:41222880-41222902 AGATGGACGACCAGAGCAGGAGG + Intergenic
1007632364 6:43279565-43279587 AAATGGCTGGATAGAGGTGGAGG - Intronic
1008661477 6:53672447-53672469 AAATGTCACAACAGAGCATGTGG - Intergenic
1009677741 6:66847844-66847866 GAGAGGCTGAACAGAACAGGAGG + Intergenic
1010610746 6:77951790-77951812 CCATGACTGTACAGAGCAGGGGG - Intergenic
1010821672 6:80422113-80422135 CACAGGCTGAACAGAGCAGTGGG - Intergenic
1011488708 6:87869265-87869287 ACATGGCGGAAGTGAGCAGGTGG + Intergenic
1011770053 6:90665756-90665778 AATTGGCTGAACTCAGGAGGTGG - Intergenic
1016586055 6:145687242-145687264 ACATGGTGGAACAGAGCAAGGGG - Intronic
1016908623 6:149175714-149175736 AAATGTGACAACAGAGCAGGAGG - Intergenic
1017789222 6:157781325-157781347 AAATGTCCTAACAGAGCAGGTGG - Intronic
1018559043 6:165082255-165082277 ACATCGCTAAAAAGAGCAGGTGG - Intergenic
1020901801 7:14012774-14012796 ATATGGCTGAACAGAGAGGCAGG + Intergenic
1020985202 7:15124920-15124942 TAATGGCTGAACATAGAGGGGGG + Intergenic
1021110919 7:16693795-16693817 AAATGTCAGAAGAGAGCTGGTGG - Intronic
1021372280 7:19863473-19863495 AAGTGGCACAACAGAGCTGGAGG - Intergenic
1022515373 7:30971875-30971897 ACTGGGCTGAACAGGGCAGGAGG - Intronic
1022584125 7:31588695-31588717 TAATAGCTGAAAAGAGAAGGAGG + Intronic
1022770005 7:33459690-33459712 AAATGGCTGATTCCAGCAGGGGG - Intronic
1023653273 7:42392424-42392446 AATTGCTTGAACACAGCAGGTGG - Intergenic
1026103289 7:67400389-67400411 AAGTGCCTGAACTCAGCAGGTGG - Intergenic
1026544981 7:71314428-71314450 TAATGACTCAACAGAGCAAGAGG + Intronic
1030175047 7:106643820-106643842 AGATGGCTGAACAGATGGGGTGG + Intergenic
1030722003 7:112881867-112881889 AAAGAGCTGAACAAAACAGGAGG + Intronic
1032239721 7:130151192-130151214 GAATGGCTGAACCCAGGAGGCGG - Intergenic
1033298144 7:140159883-140159905 GAATGGCTATACAAAGCAGGAGG - Intronic
1033535362 7:142307491-142307513 ACCTTGCTGACCAGAGCAGGAGG + Intergenic
1033980856 7:147163782-147163804 AAATGGAAGAACAGAGTAGATGG + Intronic
1034557558 7:151859715-151859737 AAGTGGCTGATGAGAGCAGAAGG - Intronic
1034766093 7:153722579-153722601 AATTGCTTGAACAGAGGAGGCGG + Intergenic
1036577324 8:10040332-10040354 AAATGGTTGAACCGAGAAGGCGG - Intergenic
1037620980 8:20563189-20563211 AAATTCCTGAACATAGAAGGCGG - Intergenic
1037971680 8:23176553-23176575 AAAAGGAAGAATAGAGCAGGAGG + Intergenic
1038005961 8:23430743-23430765 AAATGGTTGAAGTGGGCAGGTGG - Exonic
1038880489 8:31605603-31605625 AATAGGCTGCACACAGCAGGGGG + Intergenic
1039741586 8:40387909-40387931 ACCTGGCTGAACAGAGGAGGTGG - Intergenic
1041514095 8:58681395-58681417 GAATTGCTGAACCGAGGAGGTGG - Intergenic
1042924793 8:73955676-73955698 AATTGCCTGAACCCAGCAGGCGG + Intronic
1043213541 8:77555060-77555082 AAATGGCTCAGAAGAGCAGAAGG + Intergenic
1043367242 8:79547438-79547460 AATTGGCTGAACCCAGGAGGAGG + Intergenic
1043370305 8:79583734-79583756 CCAAGGCTGCACAGAGCAGGTGG - Intergenic
1043755325 8:83996369-83996391 AAAATGCTGAACAGAGCATTTGG - Intergenic
1044712653 8:95072590-95072612 AAAAGGCTGAACATACCACGAGG - Intronic
1045106010 8:98893300-98893322 AAGTGCCTGAACCGAGGAGGTGG + Intronic
1045960688 8:107964650-107964672 AAATGGCTGAACAGAGCAGGGGG - Intronic
1049476825 8:142800774-142800796 AAATAGCAGGAGAGAGCAGGTGG - Intergenic
1049883337 9:12660-12682 AAATGGTAGAACGGAGCAGCTGG + Intergenic
1050671244 9:7999720-7999742 AAGTGGATGAACTAAGCAGGAGG - Intergenic
1051067880 9:13126691-13126713 AAAGAGCTTAACAGAGCATGGGG - Exonic
1054193762 9:62009629-62009651 GAATGGCTGAACCCAGGAGGCGG - Intergenic
1054644645 9:67579062-67579084 GAATGGCTGAACCCAGGAGGCGG + Intergenic
1054907423 9:70423051-70423073 AAATGGAGTAACAGTGCAGGAGG - Intergenic
1055223795 9:73969883-73969905 CCATGACTGAATAGAGCAGGGGG - Intergenic
1055309790 9:74966698-74966720 AAGTGGATTAACAGAGCAAGAGG + Intergenic
1055878222 9:80968585-80968607 AAATGGCAGAACTGAGCAGTGGG + Intergenic
1056543003 9:87590454-87590476 AAATGGCTGATCAGAGTTGAAGG - Intronic
1057572445 9:96214882-96214904 ACAGTGCTGAGCAGAGCAGGGGG + Intergenic
1058200022 9:102027848-102027870 ACATGCCTTAACAGAGAAGGTGG + Intergenic
1058240170 9:102548149-102548171 ATGAGGCTGAACAGAGCAGGGGG - Intergenic
1059364359 9:113774435-113774457 AATTGGTTGAACCCAGCAGGTGG + Intergenic
1061175292 9:128991992-128992014 GAATGGCTGAACCCAGGAGGCGG - Intronic
1062354739 9:136156647-136156669 AGATTGCTGAACAGAGCGGGCGG - Intergenic
1185699996 X:2223604-2223626 GAAGGACAGAACAGAGCAGGAGG + Intronic
1187116332 X:16355782-16355804 AAATGCATGAACAGATAAGGTGG + Intergenic
1189071333 X:37866818-37866840 CCAAGGCTGCACAGAGCAGGGGG + Intronic
1189176591 X:38963639-38963661 CCAAGGCTGCACAGAGCAGGGGG + Intergenic
1189629742 X:42940419-42940441 ACATGGCAGGAAAGAGCAGGTGG - Intergenic
1189835226 X:45013628-45013650 AACAGGATCAACAGAGCAGGGGG - Intronic
1190303769 X:49071289-49071311 AAATGCCTAAGCAGAGCTGGAGG + Exonic
1190809320 X:53868357-53868379 AAATATCTGAATAGAGAAGGTGG - Intergenic
1191634090 X:63357422-63357444 AAAGGGGTCAATAGAGCAGGAGG + Intergenic
1191680009 X:63831220-63831242 CCAAGGCTGTACAGAGCAGGGGG - Intergenic
1192534815 X:71918110-71918132 AAAAGGCTAGACAGAGCAGGAGG + Intergenic
1192782894 X:74312106-74312128 AAATGTCAGAACATAGGAGGAGG + Intergenic
1193195879 X:78631346-78631368 CAAAGGCTGAACACAGCAGGAGG - Intergenic
1193346720 X:80412234-80412256 ACTTGGCTGCACACAGCAGGGGG + Intronic
1193506259 X:82348267-82348289 ACAAGGCTGCATAGAGCAGGGGG + Intergenic
1193696112 X:84708941-84708963 AGATGGCTGTCCAGAGCAGTTGG + Intergenic
1194598879 X:95895332-95895354 AAGTGACTGAACAGAGCATATGG - Intergenic
1194905917 X:99576269-99576291 CCAAGGCTGCACAGAGCAGGAGG - Intergenic
1194929388 X:99867771-99867793 TCAAGGCTGCACAGAGCAGGGGG - Intergenic
1195923019 X:110001951-110001973 AAATAGTGGATCAGAGCAGGAGG + Intergenic
1196601956 X:117611754-117611776 AACTGGCTCCACAGAGCAAGAGG + Intergenic
1197583250 X:128311093-128311115 CAAAGGCTGCACAGAGCTGGGGG + Intergenic
1198952084 X:142082781-142082803 ACGAGGCTGCACAGAGCAGGGGG + Intergenic
1199083681 X:143605791-143605813 CCAAGGCTGCACAGAGCAGGGGG - Intergenic
1200205986 X:154316707-154316729 AAATGGCCCAGCAGAGCATGGGG - Intronic
1200402476 X:156027488-156027510 AAATGGTAGAACGGAGCAGCTGG - Intergenic
1201866064 Y:18656719-18656741 AAATGGCTAAACTGAACAGAAGG + Intergenic