ID: 1045960689

View in Genome Browser
Species Human (GRCh38)
Location 8:107964651-107964673
Sequence GAAATGGCTGAACAGAGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 324}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045960689_1045960700 12 Left 1045960689 8:107964651-107964673 CCCCTGCTCTGTTCAGCCATTTC 0: 1
1: 0
2: 0
3: 22
4: 324
Right 1045960700 8:107964686-107964708 CTCTTCTGCTTTGCAGGGGGTGG No data
1045960689_1045960697 7 Left 1045960689 8:107964651-107964673 CCCCTGCTCTGTTCAGCCATTTC 0: 1
1: 0
2: 0
3: 22
4: 324
Right 1045960697 8:107964681-107964703 GGTAACTCTTCTGCTTTGCAGGG No data
1045960689_1045960701 13 Left 1045960689 8:107964651-107964673 CCCCTGCTCTGTTCAGCCATTTC 0: 1
1: 0
2: 0
3: 22
4: 324
Right 1045960701 8:107964687-107964709 TCTTCTGCTTTGCAGGGGGTGGG No data
1045960689_1045960704 16 Left 1045960689 8:107964651-107964673 CCCCTGCTCTGTTCAGCCATTTC 0: 1
1: 0
2: 0
3: 22
4: 324
Right 1045960704 8:107964690-107964712 TCTGCTTTGCAGGGGGTGGGGGG No data
1045960689_1045960702 14 Left 1045960689 8:107964651-107964673 CCCCTGCTCTGTTCAGCCATTTC 0: 1
1: 0
2: 0
3: 22
4: 324
Right 1045960702 8:107964688-107964710 CTTCTGCTTTGCAGGGGGTGGGG No data
1045960689_1045960699 9 Left 1045960689 8:107964651-107964673 CCCCTGCTCTGTTCAGCCATTTC 0: 1
1: 0
2: 0
3: 22
4: 324
Right 1045960699 8:107964683-107964705 TAACTCTTCTGCTTTGCAGGGGG No data
1045960689_1045960703 15 Left 1045960689 8:107964651-107964673 CCCCTGCTCTGTTCAGCCATTTC 0: 1
1: 0
2: 0
3: 22
4: 324
Right 1045960703 8:107964689-107964711 TTCTGCTTTGCAGGGGGTGGGGG No data
1045960689_1045960696 6 Left 1045960689 8:107964651-107964673 CCCCTGCTCTGTTCAGCCATTTC 0: 1
1: 0
2: 0
3: 22
4: 324
Right 1045960696 8:107964680-107964702 AGGTAACTCTTCTGCTTTGCAGG No data
1045960689_1045960698 8 Left 1045960689 8:107964651-107964673 CCCCTGCTCTGTTCAGCCATTTC 0: 1
1: 0
2: 0
3: 22
4: 324
Right 1045960698 8:107964682-107964704 GTAACTCTTCTGCTTTGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045960689 Original CRISPR GAAATGGCTGAACAGAGCAG GGG (reversed) Intronic
900521059 1:3105790-3105812 GAAGGGGCTGCACACAGCAGTGG - Intronic
905857111 1:41321476-41321498 GCAAAGGCAGAGCAGAGCAGTGG - Intergenic
907615520 1:55920867-55920889 GACATGACAGAACACAGCAGTGG - Intergenic
907618836 1:55954592-55954614 GAAGTGGCATAACAGATCAGTGG + Intergenic
908097056 1:60750195-60750217 GAGATGGTGGAAGAGAGCAGTGG - Intergenic
909878805 1:80847176-80847198 GAAATGGTTAAACAGAGCTCAGG + Intergenic
910073470 1:83247445-83247467 GCAAAGGAGGAACAGAGCAGTGG - Intergenic
910557854 1:88556286-88556308 GAAATGGAAGAACAGATCACTGG - Intergenic
910950832 1:92646486-92646508 TAAATGGCTGAACATTACAGGGG + Intronic
911086117 1:93978715-93978737 CATATGGTTGACCAGAGCAGAGG - Intergenic
912301343 1:108520284-108520306 GAAAGCTCTGAAGAGAGCAGTGG - Intergenic
912334161 1:108846967-108846989 GAAAGGGCTGAAGAGAGGAAGGG - Intronic
912496845 1:110097432-110097454 GAAAGGGCTGCCCAGAGCACTGG + Intergenic
914747885 1:150512761-150512783 GAAATGGCAGGTCACAGCAGCGG - Exonic
915089750 1:153416230-153416252 GAAATGGGAGAAAAGAGCACTGG - Intergenic
916687868 1:167163590-167163612 TAAAAAGCTGAACAGCGCAGAGG - Intergenic
917308758 1:173655620-173655642 GACAGGTCTGAAGAGAGCAGTGG - Intronic
918232961 1:182552437-182552459 GAGGTTGGTGAACAGAGCAGTGG + Intronic
920216921 1:204367498-204367520 GAGATGGCTCAACAAAGTAGAGG - Intronic
921059355 1:211569833-211569855 AAAAAGGCTGAATAGAGTAGTGG + Intergenic
921362256 1:214340985-214341007 GAAATGGCTTAATAGAGAATTGG - Intergenic
921532922 1:216307448-216307470 GCAATGGGTGAACAGGGCTGAGG + Intronic
921681879 1:218043478-218043500 GAATTGGCTGAACAGAGGGTCGG + Intergenic
923267788 1:232331080-232331102 GAAATTGCTGAATTGTGCAGTGG + Intergenic
923281616 1:232448620-232448642 GTTATGGCTCAGCAGAGCAGAGG + Intronic
924733443 1:246732968-246732990 CAAATGGCTGAACAGCAGAGTGG - Intronic
1063245784 10:4216875-4216897 GGAATGGCTGAACTCAGCAGAGG + Intergenic
1064004846 10:11691470-11691492 GAATTTGCTGAACAGACCTGGGG + Intergenic
1064453199 10:15462138-15462160 GGAATGTATGAACAGAGCACAGG - Intergenic
1067232620 10:44422750-44422772 GAATTCCCTGGACAGAGCAGCGG + Intergenic
1067461267 10:46460341-46460363 GCACTGGCTGAAAAAAGCAGGGG - Intergenic
1067625928 10:47924260-47924282 GCACTGGCTGAAAAAAGCAGGGG + Intergenic
1068146620 10:53079511-53079533 GAAATGTCTGAACATTCCAGTGG - Intergenic
1069413287 10:68174579-68174601 GAGAAGGCAGAACAGAGCTGAGG - Exonic
1069456998 10:68561096-68561118 GAGATGGCTGAATATACCAGCGG + Intronic
1069926480 10:71854211-71854233 AAACTGGCTGGACAGAGCAACGG + Intergenic
1070767639 10:79065984-79066006 GAAGTGGCTGCAGAGGGCAGAGG - Intergenic
1071326400 10:84523070-84523092 GCAGTGGCTGAACAAACCAGAGG - Intergenic
1071922858 10:90371337-90371359 GACAGCTCTGAACAGAGCAGTGG - Intergenic
1072792231 10:98326744-98326766 CAAATGGCAGAACACAGCAGAGG + Intergenic
1073188721 10:101634540-101634562 GAAATAGGTGAATAGATCAGTGG + Intronic
1073491430 10:103855572-103855594 GAACTGGCGGAGCAGAGGAGGGG + Intergenic
1074078547 10:110150658-110150680 GACATTGATGAACAAAGCAGGGG + Intergenic
1076854022 10:133106461-133106483 GCAGGGGCTGAAGAGAGCAGAGG - Intronic
1077695043 11:4386050-4386072 GAGATGGCAGGTCAGAGCAGGGG - Intronic
1081086626 11:38810305-38810327 AAAATGGGTGGACAGAGCTGAGG - Intergenic
1081676183 11:44971078-44971100 GAAAGGGCTGAGCACAGCAGCGG + Intergenic
1083652934 11:64213907-64213929 GAAATGGCAAAACAAAGAAGTGG - Intronic
1084353089 11:68617812-68617834 GGATTGGCTGAAAAGAGCACAGG + Intergenic
1084945594 11:72636730-72636752 GAAATGGCTGAAGAATGGAGGGG - Intronic
1085715683 11:78871099-78871121 AAAATGGCTGTGAAGAGCAGTGG + Intronic
1088147615 11:106701485-106701507 GAAAATGGTGAAGAGAGCAGTGG - Intronic
1088754314 11:112872979-112873001 GAAGTGGCTCGACAGGGCAGTGG - Intergenic
1090537261 11:127657066-127657088 GTAATTGTTGTACAGAGCAGAGG - Intergenic
1090658495 11:128863423-128863445 GTAATGGCAGAACACAGCACAGG + Intronic
1090723020 11:129494099-129494121 GAGAGCGCTGAAGAGAGCAGTGG + Intergenic
1090840040 11:130479420-130479442 GAAATGCGTGAGCTGAGCAGAGG - Intergenic
1092246289 12:6866223-6866245 AGAATGGCTGGGCAGAGCAGAGG + Exonic
1093878185 12:24374469-24374491 GAGAGGGCAGAACAGAGCATAGG - Intergenic
1094135365 12:27119818-27119840 GAAAGCTCTGAAGAGAGCAGGGG - Intergenic
1095605947 12:44068068-44068090 GAAATGTCTGAAGTTAGCAGAGG - Intronic
1096845506 12:54404357-54404379 GAAATTTCTCAACAGAGCTGAGG - Intronic
1099004982 12:77225102-77225124 GCAATGACTGAGCTGAGCAGAGG - Intergenic
1099210113 12:79774486-79774508 CAAATGGCTGAACTGTTCAGTGG + Exonic
1099685008 12:85874125-85874147 GAAATGGGGGAGGAGAGCAGGGG + Intergenic
1100424680 12:94473191-94473213 TCAATGGCTGAGCACAGCAGGGG - Intergenic
1100574195 12:95874345-95874367 GAGATGGATGAGCAGGGCAGTGG + Intronic
1100673774 12:96844841-96844863 GGAGAGGCTGCACAGAGCAGGGG - Intronic
1102196212 12:111026869-111026891 GGAAGAGCTGTACAGAGCAGGGG + Intergenic
1103389365 12:120560065-120560087 GAAATGGTGGACCAGCGCAGTGG - Intronic
1103513489 12:121491099-121491121 GAAATGCATAAACATAGCAGGGG + Intronic
1103902852 12:124312170-124312192 GAAACGGCTGAATAGACCTGGGG - Intronic
1105214342 13:18275455-18275477 GAAACTGCTGAGCAGGGCAGGGG - Intergenic
1106714547 13:32374132-32374154 CCCATGGCTGCACAGAGCAGTGG + Intronic
1107689080 13:42933946-42933968 GAAATGCCTGGTCAGGGCAGGGG + Intronic
1109382632 13:61584692-61584714 GAAATGGCTTCACTGAGGAGGGG - Intergenic
1110072879 13:71199984-71200006 AAGAGGGCTTAACAGAGCAGTGG + Intergenic
1110369814 13:74727453-74727475 GGAAGGGCAGAACAGAGCAGGGG + Intergenic
1111850928 13:93573834-93573856 GAAATGGATGAGCAGAGAAAGGG - Intronic
1114324710 14:21577020-21577042 GAAAGGTCTTAACAGATCAGAGG - Intergenic
1115366871 14:32567948-32567970 GAAGTGGGGGAAGAGAGCAGAGG + Intronic
1115554908 14:34537537-34537559 GAAATGGCTGGAGTGAACAGTGG - Intronic
1117519886 14:56540867-56540889 CAACAGGCTGAACAGAACAGAGG + Intronic
1117900600 14:60528777-60528799 GACAGTGCTGAAGAGAGCAGTGG - Intergenic
1118602578 14:67480995-67481017 GAAGTTGCTGAACAGAAGAGAGG + Intronic
1119213527 14:72850542-72850564 GCAGTGACTGAACAGAGCAGGGG - Intronic
1119706672 14:76787364-76787386 AAAATGGCTAACCACAGCAGAGG - Exonic
1120279558 14:82421725-82421747 CAAATGGCTTAACATAGGAGTGG - Intergenic
1120453404 14:84700372-84700394 GAAATATCGGAACAGAGCTGTGG - Intergenic
1120800774 14:88686071-88686093 GAAATGGGAGCACAGAGCAGTGG + Intronic
1121223372 14:92303114-92303136 GAAACAGTTGAACAGAACAGGGG - Intergenic
1121369808 14:93346919-93346941 GAAAAGGCGGGGCAGAGCAGGGG + Intronic
1121644765 14:95510265-95510287 GAAATGGATTCACAGAGCAGAGG + Intergenic
1122892958 14:104741524-104741546 GATATGGCTGTACAGACCATCGG - Intronic
1123110031 14:105862926-105862948 GAGATGCCTGAACAAACCAGGGG - Intergenic
1125360347 15:38858079-38858101 CAAATGCATGAGCAGAGCAGTGG - Intergenic
1126961074 15:53995242-53995264 AAAAAGTCTGAAAAGAGCAGAGG + Intergenic
1127333922 15:57965273-57965295 GAATTGACTAAACAGAGAAGGGG + Intronic
1127447081 15:59074518-59074540 GAAAAGTCTGAAGATAGCAGAGG - Intronic
1127642821 15:60931419-60931441 GGAATAGCTGAAGAGAGAAGAGG + Intronic
1129268917 15:74409434-74409456 GAAATGGATGGACAGGGCTGGGG + Exonic
1129543632 15:76372320-76372342 GAAATGGGTGGAGAGAGCACTGG - Intronic
1129850659 15:78791764-78791786 GAAATGGAATAGCAGAGCAGTGG - Intronic
1132781230 16:1626981-1627003 GGAATGGCCAAGCAGAGCAGTGG - Intronic
1133056810 16:3149512-3149534 GACATGTCTGGCCAGAGCAGAGG + Intronic
1133107605 16:3523310-3523332 GGAATGGCTGAACAGAGGACAGG - Intronic
1133390155 16:5403792-5403814 GAAATCACTGAATAGAGCAGTGG - Intergenic
1135541494 16:23333414-23333436 GAAATGGCCAAGCAGAGAAGAGG - Intronic
1136284410 16:29232769-29232791 GAAGTGGCTGAACACAGCCCAGG + Intergenic
1137832128 16:51554018-51554040 GAAATAGCTGAACTGAACAAGGG + Intergenic
1138046313 16:53729152-53729174 AAAGGGGCTGAACACAGCAGTGG - Intronic
1138091146 16:54175663-54175685 GAAAGGACAGAACAGAGGAGAGG + Intergenic
1138246293 16:55469366-55469388 GGAAAGGCTAAACAGAGCACTGG - Intronic
1139277952 16:65745337-65745359 GAAATGGCTGAAGGTACCAGGGG + Intergenic
1140147452 16:72324983-72325005 GAAAGCTCTGAAGAGAGCAGTGG + Intergenic
1141142571 16:81506397-81506419 GAAATGGCTGAGCATAACTGAGG - Intronic
1142089444 16:88202281-88202303 GAAGTGGCTGAACACAGCCCAGG + Intergenic
1143354367 17:6314582-6314604 GAAGTGGCTCAAGAGAGCTGGGG - Intergenic
1144158356 17:12530970-12530992 AATATAGCTGAACAGAGCAATGG - Intergenic
1144786599 17:17835806-17835828 GAAAGGGCGGAGCAGAACAGTGG - Intronic
1146227536 17:31079821-31079843 GAAATGTCTGGAGAGAGGAGGGG - Intergenic
1147154235 17:38535526-38535548 GTAATGGATGAGCAGAGGAGAGG - Intronic
1147310593 17:39593803-39593825 GAAAAGGAAGAAGAGAGCAGAGG + Intergenic
1147564843 17:41529733-41529755 GGAATTGTTGAACAGAGCAAGGG - Intergenic
1148218959 17:45849191-45849213 GGAAGGGCTGGACAGAGCCGAGG + Intergenic
1148721948 17:49760020-49760042 GAAATGGGTTAAGAGAGGAGAGG + Intronic
1148952606 17:51327021-51327043 GACATTTCTGAAGAGAGCAGTGG + Intergenic
1149137986 17:53393267-53393289 CCAATGGCTGAACCTAGCAGTGG - Intergenic
1149287856 17:55185847-55185869 GAAAAGGGTGAACTGAGCAGAGG + Intergenic
1152200570 17:78943545-78943567 AACAAGGCAGAACAGAGCAGTGG + Intergenic
1153795293 18:8616422-8616444 GCACAGGCTGAACAGAGCACTGG + Intronic
1155164187 18:23219325-23219347 GCAATGTCTGATTAGAGCAGAGG + Intronic
1160340664 18:78086257-78086279 GAAATGTCTGGTCAGAGAAGGGG - Intergenic
1161199140 19:3004936-3004958 GAACAGGCTGGACAGAGCTGGGG - Intronic
1163774150 19:19208210-19208232 GTACTGGCAGACCAGAGCAGAGG - Intergenic
1165120282 19:33554307-33554329 GAAAGGGCTGAAAAGAGCGCTGG + Intergenic
1166939500 19:46354148-46354170 GAGATGGCTGAGCAGAGCTGTGG - Intronic
926233630 2:11023286-11023308 GAGATGGCTCAGCAGGGCAGAGG - Intergenic
926926457 2:17993139-17993161 CCCAAGGCTGAACAGAGCAGGGG - Intronic
927187540 2:20492448-20492470 GAGATGGATAAGCAGAGCAGAGG - Intergenic
928408352 2:31032569-31032591 GAAATGACTGAGCAGCCCAGAGG + Intronic
928444587 2:31321854-31321876 GCAATGGCTGAGCAGTCCAGTGG + Intergenic
928454016 2:31403204-31403226 GAAATGCCTGGGCAGAGCTGTGG + Intronic
928974968 2:37076910-37076932 GAAATCTCTGAAAAGTGCAGAGG - Exonic
929787775 2:45004535-45004557 GAAAGGGAGAAACAGAGCAGAGG + Intergenic
930186831 2:48419564-48419586 GTAACGGCTGAGCAGAGAAGTGG - Intergenic
930485714 2:52008216-52008238 GCAATGGCAGCAAAGAGCAGTGG - Intergenic
930840161 2:55837061-55837083 GACAGCTCTGAACAGAGCAGTGG - Intergenic
933414255 2:81965730-81965752 GAAATGTCTGAAGCTAGCAGAGG + Intergenic
933489138 2:82963212-82963234 GAAATTGTTCAACAGAGCCGAGG - Intergenic
934299977 2:91771286-91771308 GAAACTGCTGAGCAGGGCAGGGG + Intergenic
937155187 2:119714036-119714058 GATGTGGCTGAACAGATGAGTGG + Intergenic
941538196 2:166747654-166747676 GATGTGGCTGAGAAGAGCAGAGG - Intergenic
941579786 2:167280535-167280557 GAAATGAGTGAAGAGTGCAGTGG + Intergenic
944229040 2:197375119-197375141 AAAATGGCTGAGCAGAGGGGAGG + Intergenic
944560391 2:200930201-200930223 GAAATGGAAGAACAGAAAAGAGG + Intronic
946204645 2:218095037-218095059 GATATGGGTGAACAGAGGAACGG + Intergenic
947229385 2:227870209-227870231 GAAATGCCTGAGGAAAGCAGCGG + Intergenic
948627296 2:239276984-239277006 AAAGGGGCTGCACAGAGCAGGGG - Intronic
1168806246 20:673970-673992 GACATGGCTGAGCAGGGCTGAGG - Intronic
1170603021 20:17856045-17856067 GAAATGGAAGATCAGAGAAGTGG + Intergenic
1170764828 20:19280867-19280889 GTGATGGCTGATCAGGGCAGCGG + Intronic
1172187233 20:33038562-33038584 GAAACGGATAAACAGAGGAGTGG - Intronic
1172399865 20:34640819-34640841 GAAAGGGCTGTATAGAGGAGTGG - Intronic
1173096049 20:40029571-40029593 GAAATGGAAGAACAGAGAAAGGG + Intergenic
1173133008 20:40411991-40412013 AAAAAGGCAGTACAGAGCAGAGG + Intergenic
1173574976 20:44107014-44107036 GAAAATGCAGAACAGGGCAGAGG - Intergenic
1173587710 20:44196156-44196178 GAAATGGCTGACCAAATCTGTGG + Intergenic
1173820700 20:46018457-46018479 GAAATGGCTGAGGAGAGAATGGG - Intergenic
1174759424 20:53192598-53192620 GAATTGGCTGCCCAGAGAAGGGG + Intronic
1175324373 20:58112453-58112475 GAAATAACTGAAAATAGCAGTGG + Intergenic
1176012625 20:62907608-62907630 GAGAGGGGTGCACAGAGCAGAGG - Intronic
1176874008 21:14107977-14107999 GAAATTGCTGGACTGAACAGGGG + Intergenic
1178164585 21:29958834-29958856 GAAAGGGCTCAAGAGACCAGAGG + Intergenic
1179144273 21:38753268-38753290 GAAATGAATGGACAGTGCAGAGG + Intergenic
1179484536 21:41701297-41701319 GAAATGAGTGAGTAGAGCAGAGG + Intergenic
1181032245 22:20154286-20154308 GCAAAGGATGAACAGGGCAGAGG - Intergenic
1181490770 22:23259602-23259624 GAATTGCCTGAACACAGGAGGGG - Intronic
1181694287 22:24585233-24585255 GACAAGGCTGCACAGACCAGAGG - Intronic
1181828825 22:25542316-25542338 GAAACTGCAGAACAGAGCAATGG + Intergenic
1183330639 22:37219013-37219035 TAAATGATTGAACAGAGCTGAGG - Intergenic
1183724487 22:39580934-39580956 GACATGGCTGAACAGGCCTGGGG - Intronic
1183750800 22:39719308-39719330 GAAATGTCTGTACTGAGGAGAGG - Intergenic
1184120709 22:42448144-42448166 GCAACGGGAGAACAGAGCAGTGG - Intergenic
1184132475 22:42525332-42525354 GCAACGGGAGAACAGAGCAGTGG - Intergenic
1184280998 22:43437462-43437484 TAAATGGCAGAACTGGGCAGTGG + Intronic
1185127834 22:49021685-49021707 GAAACGGGTCCACAGAGCAGAGG - Intergenic
951071151 3:18330668-18330690 GACAGCTCTGAACAGAGCAGTGG - Intronic
951381410 3:21988556-21988578 GACAGCTCTGAACAGAGCAGTGG - Intronic
951439131 3:22702559-22702581 AAAATGGCTGAAGAGAGAAAGGG + Intergenic
951530033 3:23690077-23690099 GAAAAGGCTGAAGAGAGGTGAGG - Intergenic
951771325 3:26260603-26260625 GAAATGGCTGGTAAGGGCAGGGG + Intergenic
953865526 3:46580026-46580048 GAAATGCCTGAGGAAAGCAGCGG - Exonic
954441524 3:50524870-50524892 CAAATATCTGAACAGAGGAGAGG + Intergenic
954616056 3:51969103-51969125 GGAAAGGCTGGGCAGAGCAGGGG + Exonic
955113728 3:55975735-55975757 GAAAGGGCTGATCAGGACAGAGG - Intronic
955592252 3:60550593-60550615 AAAATGACAGAACAGAGAAGAGG - Intronic
956070029 3:65439126-65439148 CAAATGGCTAAATAAAGCAGAGG + Intronic
957563961 3:81861324-81861346 GAAATGGCTGAAAAGTCTAGTGG + Intergenic
958069596 3:88593336-88593358 GAATTGGATGAACAAAGAAGTGG + Intergenic
958633982 3:96718815-96718837 GAAATGTCTGAAGCTAGCAGAGG + Intergenic
959692954 3:109219196-109219218 GACATCTCTGAAGAGAGCAGTGG + Intergenic
960860590 3:122148740-122148762 GACATGGCTGACCAGGGCACAGG + Intergenic
962516384 3:136155854-136155876 GAAATGCCTGAGGAAAGCAGCGG - Intronic
963451892 3:145492402-145492424 GAAATGGCTGAAAAGAACAATGG - Intergenic
964503769 3:157376340-157376362 TAACTGGCTGAGCTGAGCAGTGG - Intronic
964643112 3:158930956-158930978 AAAATGGCTGAAGTCAGCAGGGG + Intergenic
964777786 3:160297388-160297410 GAAATGGCATAAGAGAGAAGTGG + Intronic
965548918 3:169944598-169944620 GATATGACAGTACAGAGCAGTGG - Intergenic
965857606 3:173107036-173107058 GCAATGGCTGTACAGAACAAAGG - Intronic
966330265 3:178804075-178804097 ATAGTGGCTGAACAGAGCTGTGG - Intronic
967036806 3:185654215-185654237 GAAATGGCTGCCCACAGCAAAGG - Intronic
967210247 3:187162141-187162163 GAGATGGCAGATCACAGCAGGGG - Intronic
967312590 3:188120092-188120114 GAAATGAATGTAAAGAGCAGGGG - Intergenic
968442208 4:629670-629692 TACAAGGCTGGACAGAGCAGGGG + Intronic
969848419 4:9937676-9937698 GAGATGGCTGAGGAGAGAAGAGG - Intronic
970362451 4:15323415-15323437 GAAGTGGCTTAACCAAGCAGAGG - Intergenic
970470423 4:16372793-16372815 GACATCTCTGAAAAGAGCAGTGG - Intergenic
970508097 4:16753513-16753535 GAAATGGCTCCACAGAGGTGTGG + Intronic
970758165 4:19451093-19451115 CACATGGCTGCACAGAGCAGGGG + Intergenic
971375161 4:26050359-26050381 GAAAAGGCGGAACAGAGAGGAGG - Intergenic
973122944 4:46545419-46545441 GAAAATGCTCAAAAGAGCAGTGG + Intergenic
975118289 4:70703819-70703841 GGAAGGGCTGAACAGAGAAGAGG + Intergenic
975528779 4:75378831-75378853 GACAGCGCTGAAGAGAGCAGTGG + Intergenic
975618663 4:76273785-76273807 TAAAAAGCTGACCAGAGCAGTGG - Intronic
975741466 4:77433202-77433224 GAAAGGACTGAACAGAGCTGAGG + Intronic
975875164 4:78827734-78827756 GTAATGGCAGAACTGAACAGTGG - Intronic
977135079 4:93294138-93294160 GACATGGGTGAAGTGAGCAGAGG + Intronic
977161110 4:93636917-93636939 GAACTGGCAGAACAGGGCAGGGG - Intronic
978605168 4:110471976-110471998 GAAATGGCTGAATTGACCAAGGG + Intronic
979060601 4:116056098-116056120 GAAATAACTGAAGAAAGCAGAGG + Intergenic
979326531 4:119386185-119386207 GACATCTCTGAAGAGAGCAGTGG - Intergenic
979487537 4:121285395-121285417 GAAAGCTCTGAAGAGAGCAGTGG + Intergenic
980166545 4:129234976-129234998 GAAGGGGCACAACAGAGCAGTGG + Intergenic
980359659 4:131748573-131748595 GAAAAGGGAGGACAGAGCAGAGG - Intergenic
980791977 4:137632162-137632184 GCAGTGGCAGCACAGAGCAGGGG - Intergenic
980885433 4:138757665-138757687 CAAATGGCTGAAAAGAGAAAAGG + Intergenic
981179787 4:141727064-141727086 GAAATGGCTAGGCAGAGCACAGG + Intronic
981538263 4:145822887-145822909 GAGATGGCAAAACAGAGCACTGG + Intronic
981649824 4:147044352-147044374 AAAACTGGTGAACAGAGCAGTGG + Intergenic
983244399 4:165270840-165270862 GACATCTCTGAAGAGAGCAGTGG - Intronic
985394173 4:189524631-189524653 GAAAGTGCTGAACAAAACAGGGG - Intergenic
985840406 5:2301255-2301277 GAACTTGCTGCAGAGAGCAGAGG + Intergenic
987258500 5:16180233-16180255 GAACTGGCTGAGCAGTGGAGCGG + Intronic
987812969 5:22862708-22862730 TAAATGGATGAACAGAACATGGG - Intergenic
988744591 5:34121877-34121899 CAAATGGCGGAACAGCTCAGGGG - Intronic
988925086 5:35981905-35981927 CCCAAGGCTGAACAGAGCAGTGG - Intronic
989080378 5:37613512-37613534 GATTTGGCTGCATAGAGCAGAGG - Intronic
990135998 5:52644975-52644997 CACAGGGCTGCACAGAGCAGTGG - Intergenic
990348737 5:54894630-54894652 GCAATGGGTTAACAGAGGAGTGG + Intergenic
991490851 5:67181392-67181414 GAAATCCCTGAGCAGAGAAGAGG + Intergenic
991592019 5:68261912-68261934 GAAATGGTGCAACAGAGGAGTGG + Intronic
991632604 5:68671455-68671477 GAACTGGGAGAACAGAGGAGAGG - Intergenic
992483536 5:77174423-77174445 GAAAGAGCTGATGAGAGCAGTGG - Intergenic
992783326 5:80147564-80147586 GGAATGGCTGATCATGGCAGGGG + Intronic
994624120 5:102196444-102196466 GACAGCGCTGAAGAGAGCAGTGG - Intergenic
994687110 5:102969313-102969335 TATATAGCTGAACAGAGCTGTGG + Intronic
994975931 5:106805683-106805705 GTAATGGCTGAAAAAAGCAATGG + Intergenic
995431481 5:112084105-112084127 GAAGTGGCTGACAAGACCAGAGG + Intergenic
997859776 5:137405913-137405935 CAAATGGGTGAACAGAGGAGAGG - Intronic
997863849 5:137443766-137443788 GAAAGGCCTGAGCAAAGCAGTGG - Intronic
999187618 5:149724420-149724442 TAAATGACTGCACAGAGCATGGG - Intergenic
999364956 5:151016895-151016917 GAAATTGCAGAACCGAGCTGGGG - Intergenic
999895196 5:156024973-156024995 GAAATGGCTAAAGAAAGCTGTGG + Intronic
1000477461 5:161728898-161728920 GATATGAATAAACAGAGCAGTGG + Intergenic
1000779510 5:165464220-165464242 GACTTGGATGGACAGAGCAGCGG + Intergenic
1000898236 5:166882244-166882266 GAATTGGCTGGAAAGAGCTGGGG - Intergenic
1001091898 5:168747965-168747987 GAAGAGGGTGTACAGAGCAGAGG + Intronic
1001709826 5:173769433-173769455 GACAGGGCTGAACTGAGCAGTGG - Intergenic
1003781692 6:9435386-9435408 GAAATGCCTGAATACAGCACTGG - Intergenic
1003896701 6:10614923-10614945 GAAAAAGCTGCACTGAGCAGAGG - Intronic
1004799268 6:19128213-19128235 GAAATGGCTGATTTGAGCACCGG + Intergenic
1006965069 6:37975010-37975032 GAAATGGCTGATCATATCATAGG + Intronic
1007943425 6:45803489-45803511 GAAATGGCCAGAGAGAGCAGGGG - Intergenic
1008381971 6:50846474-50846496 CAAATGTCTGAAGAGTGCAGGGG - Exonic
1008722241 6:54369967-54369989 GAAATGGCCAAACAGGGAAGAGG + Intronic
1009431168 6:63567939-63567961 GAAAAGTCTGAAGATAGCAGAGG - Intronic
1010821673 6:80422114-80422136 CCACAGGCTGAACAGAGCAGTGG - Intergenic
1012311893 6:97735618-97735640 GAAATTGCTGCCAAGAGCAGTGG - Intergenic
1013401265 6:109798704-109798726 GAGATGGCTAATCAGAGAAGTGG + Intronic
1016334921 6:142994379-142994401 GACATCTCTGAAGAGAGCAGTGG + Intergenic
1018008687 6:159648033-159648055 GAAATGACTGAATACAGGAGAGG - Intergenic
1018133189 6:160752038-160752060 GATATTCCAGAACAGAGCAGCGG - Intronic
1019301281 7:305300-305322 GAAAGGGGTGCACAGAGCCGTGG + Intergenic
1019413652 7:917434-917456 GAAATGGCTGAACACAGTCCTGG - Intronic
1019699837 7:2469203-2469225 GAGAGGGAGGAACAGAGCAGAGG + Intergenic
1020405495 7:7828801-7828823 GGAATTACTGAACAGATCAGAGG + Intronic
1020649473 7:10856776-10856798 GGAATGGGGGAAAAGAGCAGCGG + Intergenic
1021193181 7:17645200-17645222 GAAAAAGCTGAACAAAGTAGAGG + Intergenic
1021229641 7:18070599-18070621 ACAATGGTGGAACAGAGCAGAGG - Intergenic
1022770006 7:33459691-33459713 GAAATGGCTGATTCCAGCAGGGG - Intronic
1024960247 7:54967097-54967119 AACATGGCTGAAAAGAGAAGGGG + Intergenic
1026431531 7:70352222-70352244 GAGTTGGCAGAACAGTGCAGGGG - Intronic
1027291154 7:76712319-76712341 GCAAAGGAGGAACAGAGCAGTGG - Intergenic
1028102466 7:86837943-86837965 GAAATGGGTGATCAGAGGGGTGG + Intronic
1032519037 7:132528739-132528761 GCAATGGCTGAACAGAGAGAAGG + Intronic
1032794943 7:135269648-135269670 GACATGTGTGGACAGAGCAGGGG + Intergenic
1033887569 7:145967181-145967203 GACAGGTCTGAAGAGAGCAGTGG + Intergenic
1033924668 7:146443396-146443418 GAAAGGGGTGGAAAGAGCAGAGG - Intronic
1037609452 8:20464071-20464093 GAGATGGGTGGACACAGCAGTGG + Intergenic
1037752891 8:21694227-21694249 CAAATGGCTGCTCTGAGCAGAGG - Intronic
1038022450 8:23561868-23561890 GAAAGGGAGGATCAGAGCAGGGG - Intronic
1038202390 8:25425679-25425701 GAGATGGCTGGACAAAGCAAGGG - Intergenic
1039530370 8:38256207-38256229 ACAGTGGCAGAACAGAGCAGTGG - Intronic
1039965499 8:42280901-42280923 GAAGTGACTGAACGGAGCAGAGG - Intronic
1041064930 8:54073419-54073441 TAAATGGCTGAGGAAAGCAGCGG - Intronic
1041079872 8:54206263-54206285 TAAATGACTGAAGAGAGCAAAGG + Intergenic
1041827885 8:62118730-62118752 AAAATGGCTTAACAGAGATGAGG - Intergenic
1041936992 8:63344167-63344189 GAAAAGGCAGAACAAAGCTGAGG - Intergenic
1043863780 8:85352620-85352642 GAAGGGGCTGGGCAGAGCAGGGG - Intronic
1044424022 8:92030705-92030727 GAAGTGGCTAAACAGATCAAAGG - Intronic
1045201783 8:99990733-99990755 TAAACGTCTGAAGAGAGCAGTGG + Intronic
1045960689 8:107964651-107964673 GAAATGGCTGAACAGAGCAGGGG - Intronic
1047432499 8:124805105-124805127 AAAATGGCTGCCCAGAGGAGGGG - Intergenic
1047673073 8:127170170-127170192 GAAAAGGCTGAATTGAGCTGTGG - Intergenic
1047747177 8:127853943-127853965 GAAAGGGCAGGACAGAGCAAGGG - Intergenic
1050320738 9:4449447-4449469 GACATCTCTGAAGAGAGCAGTGG + Intergenic
1050952849 9:11618788-11618810 GAAGGGGCAGAGCAGAGCAGAGG - Intergenic
1052342654 9:27378953-27378975 GAGGAGGCAGAACAGAGCAGTGG - Intronic
1053429135 9:38030434-38030456 CAAAGGGCTGCAGAGAGCAGAGG + Intronic
1055433902 9:76272855-76272877 GGAAAGGCTGGACAGATCAGTGG - Intronic
1055878221 9:80968584-80968606 AAAATGGCAGAACTGAGCAGTGG + Intergenic
1056071919 9:82996187-82996209 GTAGTGGCTGAACAGAGGACTGG - Intronic
1057961262 9:99459535-99459557 GGAATGGCAGAGCAGAGAAGTGG + Intergenic
1058180378 9:101791193-101791215 GAAATGGGTGAAGAAAACAGAGG + Intergenic
1058240171 9:102548150-102548172 CATGAGGCTGAACAGAGCAGGGG - Intergenic
1058628108 9:106956800-106956822 GAAATGTCTGAAGCTAGCAGAGG - Intronic
1059223248 9:112646012-112646034 GAAATGCCTGAAAAGTTCAGAGG + Intronic
1060768757 9:126314920-126314942 GAAAGGGATGACCAGAGCTGAGG + Intergenic
1062694193 9:137864754-137864776 GAAACTCCTGAACAGAGCAGTGG + Intronic
1186587491 X:10891009-10891031 GAAAAGGCTGAACAGGTGAGTGG + Intergenic
1187725537 X:22198596-22198618 GATATGGCAGAACATAGCACAGG + Intronic
1189519676 X:41752702-41752724 AAAATGGCTGAAAGGAGGAGGGG + Intronic
1189558941 X:42172857-42172879 GAATTTGCTGAATAGAGAAGTGG + Intergenic
1189835227 X:45013629-45013651 GAACAGGATCAACAGAGCAGGGG - Intronic
1190737334 X:53264360-53264382 GAATTGGCTGAATCGGGCAGAGG - Intronic
1191121616 X:56912361-56912383 GACAGTGCTGAAGAGAGCAGTGG - Intergenic
1192371814 X:70520657-70520679 GACATCTCTGAAGAGAGCAGTGG - Intergenic
1192949104 X:75997642-75997664 GAAAGCTCTGAAAAGAGCAGTGG - Intergenic
1193342849 X:80371663-80371685 GAAATGTCTGAAGCTAGCAGAGG - Intronic
1193577748 X:83223984-83224006 GAAGTGGTTGAAAAGAGCTGAGG + Intergenic
1194944158 X:100048462-100048484 CCCATGGCTGCACAGAGCAGTGG - Intergenic
1195975474 X:110521543-110521565 GAAATGCCTGAGGAAAGCAGCGG - Intergenic
1197886305 X:131221769-131221791 GAAATAGTAGAAAAGAGCAGAGG - Intergenic
1199115613 X:143988640-143988662 GAAATGGTTGAACAGAGAGGGGG - Intergenic
1200367424 X:155681825-155681847 GAAAAGTCTGAACCTAGCAGAGG + Intergenic
1200405889 Y:2811156-2811178 GAAAGCTCTGAAGAGAGCAGTGG - Intergenic