ID: 1045960690

View in Genome Browser
Species Human (GRCh38)
Location 8:107964652-107964674
Sequence AGAAATGGCTGAACAGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 360}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045960690_1045960696 5 Left 1045960690 8:107964652-107964674 CCCTGCTCTGTTCAGCCATTTCT 0: 1
1: 0
2: 0
3: 29
4: 360
Right 1045960696 8:107964680-107964702 AGGTAACTCTTCTGCTTTGCAGG No data
1045960690_1045960698 7 Left 1045960690 8:107964652-107964674 CCCTGCTCTGTTCAGCCATTTCT 0: 1
1: 0
2: 0
3: 29
4: 360
Right 1045960698 8:107964682-107964704 GTAACTCTTCTGCTTTGCAGGGG No data
1045960690_1045960703 14 Left 1045960690 8:107964652-107964674 CCCTGCTCTGTTCAGCCATTTCT 0: 1
1: 0
2: 0
3: 29
4: 360
Right 1045960703 8:107964689-107964711 TTCTGCTTTGCAGGGGGTGGGGG No data
1045960690_1045960699 8 Left 1045960690 8:107964652-107964674 CCCTGCTCTGTTCAGCCATTTCT 0: 1
1: 0
2: 0
3: 29
4: 360
Right 1045960699 8:107964683-107964705 TAACTCTTCTGCTTTGCAGGGGG No data
1045960690_1045960702 13 Left 1045960690 8:107964652-107964674 CCCTGCTCTGTTCAGCCATTTCT 0: 1
1: 0
2: 0
3: 29
4: 360
Right 1045960702 8:107964688-107964710 CTTCTGCTTTGCAGGGGGTGGGG No data
1045960690_1045960704 15 Left 1045960690 8:107964652-107964674 CCCTGCTCTGTTCAGCCATTTCT 0: 1
1: 0
2: 0
3: 29
4: 360
Right 1045960704 8:107964690-107964712 TCTGCTTTGCAGGGGGTGGGGGG No data
1045960690_1045960700 11 Left 1045960690 8:107964652-107964674 CCCTGCTCTGTTCAGCCATTTCT 0: 1
1: 0
2: 0
3: 29
4: 360
Right 1045960700 8:107964686-107964708 CTCTTCTGCTTTGCAGGGGGTGG No data
1045960690_1045960701 12 Left 1045960690 8:107964652-107964674 CCCTGCTCTGTTCAGCCATTTCT 0: 1
1: 0
2: 0
3: 29
4: 360
Right 1045960701 8:107964687-107964709 TCTTCTGCTTTGCAGGGGGTGGG No data
1045960690_1045960697 6 Left 1045960690 8:107964652-107964674 CCCTGCTCTGTTCAGCCATTTCT 0: 1
1: 0
2: 0
3: 29
4: 360
Right 1045960697 8:107964681-107964703 GGTAACTCTTCTGCTTTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045960690 Original CRISPR AGAAATGGCTGAACAGAGCA GGG (reversed) Intronic
900893629 1:5467488-5467510 AGAAATGGCAGCACGGAGCCAGG + Intergenic
902602523 1:17550022-17550044 AGAACTGGCTGTAGAGAGCCAGG + Intronic
902985241 1:20150633-20150655 AGAAATGGGTGGAGAGAGTACGG - Intergenic
903136286 1:21311297-21311319 ATAAATGGGTGGACAGAGGAGGG - Intronic
904378473 1:30096038-30096060 AGAACTGCATGAACTGAGCAGGG - Intergenic
904536278 1:31201764-31201786 AGAAGTGGTGGAAAAGAGCAAGG - Intronic
906405491 1:45538711-45538733 AGAAAGTGCTGAACAGGGCCGGG + Intergenic
907301084 1:53486717-53486739 AGGCAAGGCTGAAAAGAGCAGGG + Intergenic
907726102 1:57021967-57021989 AGAAAATGCAGACCAGAGCATGG - Intronic
909876235 1:80807300-80807322 AGAACTGTCTGAAGGGAGCAAGG + Intergenic
912334162 1:108846968-108846990 GGAAAGGGCTGAAGAGAGGAAGG - Intronic
912749751 1:112276736-112276758 AGAAATGGCATAACATTGCAAGG + Intergenic
913082933 1:115406376-115406398 AGAAATGGAAGAACAAAGCCTGG - Intergenic
913326287 1:117631281-117631303 TGAAATGGCTGAAAACAGCCTGG - Intergenic
916168390 1:161982918-161982940 AGGAGTAGCAGAACAGAGCAAGG + Intergenic
918285561 1:183051367-183051389 AGGAAAGGCTGGACAGAGCTAGG - Intronic
918662865 1:187111247-187111269 AGAAATTGTTCAACAGATCATGG + Intergenic
918987815 1:191656169-191656191 AGAAAAGGCTGAACAGATGATGG - Intergenic
922353041 1:224750440-224750462 AAAAATGGCTTGAGAGAGCAAGG - Intergenic
923190463 1:231615266-231615288 ATTAATGTGTGAACAGAGCATGG - Intronic
923468770 1:234271822-234271844 AGAAATGTGTGAAGAGAACAAGG + Intronic
924110263 1:240691951-240691973 AGAAATTGCTCAACAGCCCACGG + Intergenic
924680410 1:246225448-246225470 AGAATGGGCTGAAAAGAGAATGG + Intronic
1063626431 10:7694485-7694507 AGAAATAGCTGACCAGGGGAAGG - Intergenic
1063899587 10:10718715-10718737 AGCAATAGCTGCACAGAGCATGG - Intergenic
1064004845 10:11691469-11691491 AGAATTTGCTGAACAGACCTGGG + Intergenic
1064206901 10:13332139-13332161 AGGAATGGCTAAATAAAGCAGGG + Intronic
1067462945 10:46471404-46471426 AGAAATGGTTGAACAGGCCCAGG + Intergenic
1067624249 10:47913234-47913256 AGAAATGGTTGAACAGGCCCAGG - Intergenic
1068199977 10:53771456-53771478 AGAAAACGATGAACATAGCAGGG + Intergenic
1068218976 10:54019076-54019098 AGAGATACCTGCACAGAGCAAGG - Intronic
1069106436 10:64388290-64388312 AGGAATGACTGAACGGAGTAAGG - Intergenic
1070901108 10:80029822-80029844 AGGAATGACTGAACATAGCTTGG - Intergenic
1072609782 10:97010591-97010613 ACAAATGAGTGAGCAGAGCATGG + Intronic
1073080800 10:100859462-100859484 AGAAAGGGGTGAGCAGAGGAGGG - Intergenic
1074894699 10:117765132-117765154 AGAAATTGCAGACCAGACCAAGG - Intergenic
1077053076 11:576382-576404 AGAAATGACTGAAGTGAGGAAGG - Intergenic
1077695044 11:4386051-4386073 AGAGATGGCAGGTCAGAGCAGGG - Intronic
1078267191 11:9764172-9764194 AGAGATGACTGGACAGACCATGG - Intergenic
1078768787 11:14327288-14327310 AAAAATAGCTGAAGAGAGGATGG + Intronic
1079088274 11:17462659-17462681 AGAAATAGCTGAACACATTATGG + Intronic
1079158528 11:17971492-17971514 AGAAATGGAACAACAGAGCCTGG + Intronic
1081729529 11:45360283-45360305 ACAAGTAGCTGAACAGAGGAGGG + Intergenic
1081807218 11:45897118-45897140 AGAAATTGAGGCACAGAGCAAGG - Intronic
1082165306 11:48942755-48942777 AGAAATGGCAGAAAATACCACGG + Intergenic
1085282867 11:75342261-75342283 AGAAATGGGTCTGCAGAGCAGGG - Intronic
1086035276 11:82407213-82407235 CTACATGGCAGAACAGAGCAAGG + Intergenic
1086994217 11:93338315-93338337 AAACATTGCTGAACAGAGCTAGG - Intronic
1088156437 11:106810101-106810123 AACAATGTCTGAAAAGAGCATGG + Exonic
1090693235 11:129207719-129207741 AGAAATGGCAGAAAACATCAGGG - Intronic
1090955831 11:131512372-131512394 AGCAAGGGCAGCACAGAGCAAGG - Intronic
1091058323 11:132439199-132439221 AGAAGTGGCTGAAGGGTGCAGGG + Intronic
1091686263 12:2564983-2565005 ATAAATGGCTGCACTGTGCAAGG - Intronic
1095123508 12:38446134-38446156 AGAAATGGCTTATCTGAGAAAGG - Intergenic
1095180573 12:39143391-39143413 AGAAATGTCTGAACAAAGCCAGG + Intergenic
1095365427 12:41398458-41398480 AGAAAAGGGAGAACAGATCAAGG - Intronic
1095651417 12:44614859-44614881 TGAAATTTTTGAACAGAGCATGG - Intronic
1096481615 12:51945320-51945342 AGAAATGGCTTTAAAGATCAAGG - Intergenic
1097606908 12:61766528-61766550 AGAAATTGTTAATCAGAGCAGGG - Intronic
1097829399 12:64207745-64207767 AGGATTGGCTGACCTGAGCAGGG - Intronic
1098213536 12:68191655-68191677 AAAAAAGGCTGATCAGAGCTGGG - Intergenic
1099685007 12:85874124-85874146 AGAAATGGGGGAGGAGAGCAGGG + Intergenic
1101435036 12:104657348-104657370 AGAATTAGCTAAACATAGCAAGG - Intronic
1102196211 12:111026868-111026890 AGGAAGAGCTGTACAGAGCAGGG + Intergenic
1103178321 12:118884666-118884688 AGAGCTGGCTGAAAAGAGTAAGG + Intergenic
1104264994 12:127223623-127223645 TGAGAAGGCTGAGCAGAGCAGGG + Intergenic
1104753124 12:131252382-131252404 AGAGATGTCTCACCAGAGCAAGG - Intergenic
1104991921 12:132629856-132629878 AGAAATGGCTAAACTTAGGAAGG - Intronic
1105896567 13:24721399-24721421 AAAAATGGCTTGAGAGAGCAGGG + Intergenic
1106344794 13:28865476-28865498 ACAAATGGCTGAGAAAAGCATGG - Intronic
1108231105 13:48342176-48342198 AGGAATGAATGAATAGAGCAAGG + Intronic
1108688569 13:52842593-52842615 AGAAACGGCTGAACTTTGCACGG + Intergenic
1109382633 13:61584693-61584715 AGAAATGGCTTCACTGAGGAGGG - Intergenic
1109532099 13:63663512-63663534 AGCAATGGCTGAAGAGTACAGGG - Intergenic
1109648235 13:65289848-65289870 AAAAATGGCAGAACAAAACAGGG + Intergenic
1110069875 13:71161448-71161470 AGAAATGGCTAAACAGAAACAGG + Intergenic
1110369813 13:74727452-74727474 GGGAAGGGCAGAACAGAGCAGGG + Intergenic
1110906206 13:80893458-80893480 ATAAATGGCTGAAGGGAGGAAGG - Intergenic
1111850929 13:93573835-93573857 AGAAATGGATGAGCAGAGAAAGG - Intronic
1112128863 13:96499319-96499341 AGAAATGTGTGAACAGGGCCAGG - Intronic
1112939428 13:104843358-104843380 AGAAATGGAACAACAGAGCCCGG - Intergenic
1113146657 13:107215432-107215454 AGCAAAGGCTGAAGAGACCAAGG + Intronic
1113634631 13:111911139-111911161 TGAAATGCCTGAACAAATCAAGG + Intergenic
1114552506 14:23541200-23541222 AGAAAGGGGTGAACAGAGGCCGG - Intronic
1114974904 14:28083535-28083557 ACAGATGGCTGAACTGAGGATGG + Intergenic
1115004067 14:28459237-28459259 AGAAATGGATGAAGAAAACATGG + Intergenic
1116593548 14:46810821-46810843 TAAAATGGCTGGATAGAGCAAGG + Intergenic
1119213528 14:72850543-72850565 TGCAGTGACTGAACAGAGCAGGG - Intronic
1119737208 14:76990802-76990824 AGAAATTGCTGAACCTAGCCGGG + Intergenic
1120034309 14:79678930-79678952 AGAAATATCTGAACCAAGCAGGG - Intronic
1120745638 14:88148573-88148595 AGAATTGGATGAAAGGAGCAGGG - Intergenic
1120970449 14:90202661-90202683 AGAAATGGCTGGACAGCTCTTGG + Intergenic
1121223373 14:92303115-92303137 AGAAACAGTTGAACAGAACAGGG - Intergenic
1121325465 14:93017137-93017159 AGAAATGGCTTTACAGAGAAAGG + Intronic
1121598525 14:95185258-95185280 GGAAATGCCTGATGAGAGCAAGG + Exonic
1121676061 14:95753967-95753989 AGAGTTGGCTGGACCGAGCAGGG + Intergenic
1121774700 14:96583004-96583026 GGAAATGGCTAAACAGAGAGAGG + Intergenic
1122026953 14:98885207-98885229 AGAAAGGGCAGAAGAGAGAAAGG - Intergenic
1122111794 14:99508514-99508536 GGCCATGGCTGAAGAGAGCAGGG + Exonic
1124164266 15:27309648-27309670 AAAAATTGCTGACAAGAGCAAGG + Intronic
1124639373 15:31386863-31386885 AGAAATGGAAGAACAAAGCCTGG + Intronic
1124801208 15:32834575-32834597 AGAATTAGATGAACAGAGCTTGG - Intronic
1125570264 15:40711664-40711686 AGAATGGGATGAACAGAGGATGG + Intronic
1125999129 15:44193712-44193734 GGAGAAGGCTGAACTGAGCACGG + Intronic
1126012396 15:44315724-44315746 GGAAAAGGCCAAACAGAGCAAGG + Intronic
1129595861 15:76963692-76963714 AGCAATGGCTGGACAGAGGCTGG + Intergenic
1130123746 15:81074677-81074699 ATAAATAGCTGAACAGGCCAAGG - Intronic
1130797047 15:87220877-87220899 AGAAATAGAAGAACAGAACAGGG - Intergenic
1130987351 15:88853259-88853281 AGATATGGCTGAAATCAGCAAGG - Intronic
1131035278 15:89218029-89218051 AGAAGTGGCTGAGCTGAGCCTGG - Intronic
1132505511 16:306520-306542 AGAAACGGGTGCACAGAGCCAGG - Intronic
1133632872 16:7638455-7638477 AGAAATGGCTGAGCAGGGAGTGG + Intronic
1136548811 16:30970771-30970793 AGATGGAGCTGAACAGAGCAGGG - Intronic
1137800187 16:51255840-51255862 GGAAATGGCTGAACTGAGACTGG - Intergenic
1137832127 16:51554017-51554039 TGAAATAGCTGAACTGAACAAGG + Intergenic
1137901702 16:52275783-52275805 AGAAATGGCACAAAATAGCATGG + Intergenic
1138516523 16:57538312-57538334 AGAAATGACTGGACTGGGCACGG + Intergenic
1139035749 16:62944312-62944334 AGAAATGGGGGAAAAGAGGAAGG - Intergenic
1139277951 16:65745336-65745358 AGAAATGGCTGAAGGTACCAGGG + Intergenic
1139708842 16:68761114-68761136 AGACAGGGCTCAACAGAGCCTGG + Intronic
1140038855 16:71391984-71392006 AGATATGGCTGAACTGAAAAGGG - Intergenic
1141236168 16:82219377-82219399 AGAAATTGCTGAAGAGAACTGGG - Intergenic
1141283431 16:82649592-82649614 TGAAATGGCTAGTCAGAGCATGG + Intronic
1141891201 16:86927832-86927854 AGAGATGACTGAAAACAGCAAGG - Intergenic
1142280321 16:89144611-89144633 AGAAATGGCAGGACAGGGCCTGG + Intronic
1142523757 17:523212-523234 AGAAATGGCTGAAGACAGAAGGG + Intronic
1143354368 17:6314583-6314605 AGAAGTGGCTCAAGAGAGCTGGG - Intergenic
1143699462 17:8647449-8647471 AGAACTGTCAGAACAGAACAGGG - Intergenic
1143703381 17:8678850-8678872 AGAAAGGGCTTCACAGAGAAAGG - Intergenic
1144328068 17:14200636-14200658 AGACATGGCTCTCCAGAGCACGG - Intronic
1145290343 17:21540099-21540121 AGAAATGTATGAACAAACCATGG + Intronic
1145295898 17:21592674-21592696 AGGAGGGGCTGAACAGTGCAGGG - Intergenic
1145367887 17:22279388-22279410 AGGAGGGGCTGAACAGTGCAGGG + Intergenic
1146890734 17:36504953-36504975 AGAAATGGCTGCACTGTGCGGGG + Intronic
1147361597 17:39934133-39934155 AGAAAGGGCTGAACTGGTCAGGG + Intergenic
1147564844 17:41529734-41529756 TGGAATTGTTGAACAGAGCAAGG - Intergenic
1149746741 17:59106443-59106465 GGCAATGGATGAACAGAGCGTGG - Exonic
1150037835 17:61823490-61823512 AGAAATAGCAGAAGAGATCAAGG + Intronic
1151605489 17:75132713-75132735 AGAAAATGCTGAACAGGGCCAGG + Intergenic
1151742458 17:75993034-75993056 AGAAATGGCAGGATAGAGCCTGG - Intronic
1152243849 17:79175194-79175216 ACACATGGCTGAACAGCGCTTGG + Intronic
1153780323 18:8489874-8489896 AGAAATGGCAGAGCTGAGCCAGG - Intergenic
1154315781 18:13302119-13302141 AGAAATAGCTGAAGACTGCAGGG - Intronic
1154490333 18:14917185-14917207 AGAAATAGCTGCACAGAAGACGG - Intergenic
1155526968 18:26726871-26726893 AGGAAAGGCAGAACAGGGCAAGG - Intergenic
1156029925 18:32700876-32700898 AGAATTGGCTGAAGTGAGTAAGG + Intronic
1156758532 18:40558257-40558279 ATATATGACTGAACAGAGAAGGG - Intergenic
1156830049 18:41480918-41480940 ACAAATGGCTGAAGGTAGCATGG + Intergenic
1159206783 18:65263924-65263946 AGATTTGGCTGATCAGAGCCAGG + Intergenic
1161395337 19:4042480-4042502 AGCAATGGCTGCACTGAGCCGGG - Intergenic
1162097186 19:8317190-8317212 AGAGAGGGGTGAACAGAGCTCGG + Intronic
1162658878 19:12154134-12154156 GAAAATGCCTGAACAGAGCCAGG + Intronic
1162671467 19:12261088-12261110 GGAAATGGCTTAAAAAAGCAAGG + Intronic
1162842549 19:13366994-13367016 AGAAATGGCAGAACTAGGCAGGG + Intronic
1164687127 19:30174236-30174258 TGAACTGGCTGGACAGAGAAGGG + Intergenic
1167766308 19:51485093-51485115 AGTAGTGGTTGATCAGAGCATGG - Exonic
925118425 2:1399142-1399164 AGGGATGGCTGAACAGAGGAGGG - Intronic
925850432 2:8076213-8076235 AGAAAAGGGTGAGCAGATCAAGG + Intergenic
925965284 2:9059969-9059991 AGCAATGGCTTGAGAGAGCAGGG + Intergenic
927119361 2:19940810-19940832 AGAAATGGCTGGACAGCACAGGG - Intronic
927239865 2:20911997-20912019 ACAAATGTCAGGACAGAGCAAGG + Intergenic
927670244 2:25062883-25062905 AGACATGGCTGAGCAGGGCTGGG + Intronic
927735794 2:25520397-25520419 AAAAATGGCTGTAAACAGCAAGG + Intronic
929440361 2:41961355-41961377 AGAATTGATTGAACAGGGCATGG - Intergenic
932333380 2:70914008-70914030 AGAAATGGCTGAACAAATAGTGG - Intronic
936495924 2:113020926-113020948 AGGAATGGCTAAACAAAGGATGG + Intergenic
937381764 2:121383657-121383679 ACATATGGCAGACCAGAGCAAGG + Intronic
938336584 2:130505592-130505614 AAAAATGGATGAACACAGCTTGG + Intronic
938353234 2:130615070-130615092 AAAAATGGATGAACACAGCTTGG - Intronic
939535275 2:143420288-143420310 AGAAAGGGATGAACAGAAGATGG + Intronic
940904746 2:159158896-159158918 AGACAAGGGTGAAAAGAGCAAGG - Intronic
941341864 2:164315889-164315911 AGAAATGGCAGGACATAGAAAGG + Intergenic
942126091 2:172827227-172827249 AAAAATGGATTAACAGAGCCGGG - Intronic
942831365 2:180239965-180239987 AGAAGTGGGGGAAGAGAGCAAGG + Intergenic
943093114 2:183397022-183397044 AGAAATCTCTGAACAGAAAAAGG - Intergenic
944115236 2:196178667-196178689 ACAAAAGGCTGAAAAGAACAAGG - Intergenic
944336132 2:198537546-198537568 AGAAAGCTCTGAGCAGAGCAGGG - Intronic
946202162 2:218076711-218076733 AGAAAGGGATGCACAGAGGAGGG - Intronic
946355076 2:219179261-219179283 GTAAATGGCAGAACAGAGAATGG - Intronic
946694781 2:222344060-222344082 AGAAATGGCTGAATAAATTATGG - Intergenic
946706922 2:222467338-222467360 AGAAATGTCTCAACAGGACATGG - Intronic
947239942 2:227983811-227983833 GGAAAAGGCTGAACAGAGCCTGG + Intronic
947666650 2:231910288-231910310 AGAAATGGCTGCTCAGGGCTGGG - Intergenic
948312029 2:236994482-236994504 GGAAATCACTGCACAGAGCAGGG - Intergenic
948341206 2:237253719-237253741 AGAGATGACTGATCAGAGCTGGG - Intergenic
948397832 2:237660812-237660834 AGCAAGGGCAGAACAGCGCACGG + Intronic
1169272061 20:4208085-4208107 AGAGATGGATGGACAGGGCAAGG - Intergenic
1169592075 20:7155714-7155736 AGTTATGACTGACCAGAGCATGG + Intergenic
1169919147 20:10715229-10715251 AGAAATACATGAACAAAGCAGGG - Intergenic
1170365739 20:15596792-15596814 AGGAATGTCTGACCAGGGCAAGG - Intronic
1170621161 20:17997459-17997481 AGATATGGCTGAACAAAGGGAGG - Intronic
1171332639 20:24354625-24354647 AAAAATGTCAGAACAGAGCCAGG - Intergenic
1171376554 20:24697905-24697927 AGATGTGTCTGAACAAAGCAAGG + Intergenic
1171444170 20:25191949-25191971 AGAACTGGCTGAACAGCCCAAGG - Intergenic
1172420302 20:34810838-34810860 AGAAATGGTTGCACAGAGTCCGG - Intronic
1172864399 20:38084635-38084657 ACAATTTGCTGAAGAGAGCAGGG - Intronic
1173096048 20:40029570-40029592 AGAAATGGAAGAACAGAGAAAGG + Intergenic
1173609729 20:44357929-44357951 AGATATGGCTGGACAGAGAAAGG + Intronic
1173820701 20:46018458-46018480 GGAAATGGCTGAGGAGAGAATGG - Intergenic
1174187679 20:48718264-48718286 AGAAATGCCTGTGCAGAGCCTGG - Intronic
1174640680 20:52041235-52041257 AGAAATAGCTTTACAAAGCATGG + Intergenic
1174726742 20:52870760-52870782 ACAAATGGCTGTGGAGAGCAAGG - Intergenic
1176874007 21:14107976-14107998 AGAAATTGCTGGACTGAACAGGG + Intergenic
1177406575 21:20675785-20675807 TGAATTGGATGAAGAGAGCAAGG - Intergenic
1178444321 21:32624768-32624790 AGAAAATGCTGAACAGGGCCAGG - Intergenic
1179106437 21:38404663-38404685 AGAAATAGCTGCCCACAGCAAGG - Intronic
1180643793 22:17320795-17320817 AGAAACGGGTGGACACAGCAGGG + Intergenic
1180976661 22:19852350-19852372 AGGGATGGCTGAACAGGGCGTGG + Exonic
1181490771 22:23259603-23259625 AGAATTGCCTGAACACAGGAGGG - Intronic
1181641959 22:24206264-24206286 AGAAATAGGTGAATTGAGCAAGG - Intergenic
1182031347 22:27161692-27161714 AGAAAAGGGAGAACAGAGGAGGG + Intergenic
1182081457 22:27532125-27532147 AGACATGGATGAACACAGCTGGG + Intergenic
1182857641 22:33532100-33532122 ATAAATGGATGAATAGAACAGGG + Intronic
949116406 3:331082-331104 ATAAAAGGCTGAACAGTGAAAGG + Intronic
949819137 3:8096120-8096142 AGAAATGACTAAGCAAAGCATGG + Intergenic
950542394 3:13620305-13620327 GGACATGGCTGCACAGACCAGGG - Intronic
950632537 3:14292763-14292785 AGAAATGGAACAACAGAGCCTGG + Intergenic
951107999 3:18768350-18768372 ATAAAAGTCTGAAAAGAGCATGG + Intergenic
951439130 3:22702558-22702580 AAAAATGGCTGAAGAGAGAAAGG + Intergenic
951771324 3:26260602-26260624 AGAAATGGCTGGTAAGGGCAGGG + Intergenic
952536600 3:34317431-34317453 TGAAATGGCTTGAGAGAGCAAGG - Intergenic
953290182 3:41652567-41652589 AGAAGAGGCTGAACTGAACAAGG + Intronic
954289473 3:49642133-49642155 AGAAATGCCTGAGCAGGGCTTGG + Intronic
956848598 3:73207050-73207072 AGAGATGGCTGTGTAGAGCAAGG - Intergenic
957164342 3:76651930-76651952 AGAAAAGGCTGGACCTAGCAAGG - Intronic
960308751 3:116094583-116094605 AGAAATGGATGTTCAGGGCAGGG + Intronic
960688114 3:120314044-120314066 AGCAGTGGCTGGTCAGAGCAAGG - Intergenic
961320480 3:126069854-126069876 GCAAATGGCTGATCTGAGCAGGG + Intronic
961585951 3:127925000-127925022 TGAAATGTCTGAACAAACCATGG - Intronic
961680896 3:128599289-128599311 AGAAATAAATGAACAGGGCAAGG - Intergenic
962364351 3:134767792-134767814 AGAGTTCCCTGAACAGAGCATGG - Intronic
962452609 3:135533167-135533189 AGAAATGACTAAACAGATCATGG - Intergenic
962818665 3:139025351-139025373 AGAATGGGCTCAAGAGAGCATGG - Intronic
963273219 3:143305764-143305786 AGAAATGACTGAAGATAACAAGG + Intronic
964319743 3:155482558-155482580 AGGTATGTCAGAACAGAGCATGG + Exonic
964412076 3:156408172-156408194 AAAAATGGCCGAACTCAGCAGGG + Intronic
965038876 3:163480007-163480029 AGAAATGTCTGAGCCGGGCATGG - Intergenic
966542379 3:181106533-181106555 AGAAATGTCTGCAGACAGCAGGG - Intergenic
966843869 3:184111181-184111203 ACAAATGCCTGAACAGCGCTGGG - Intergenic
966930958 3:184675175-184675197 AGAAAGTGCTGGACAGGGCATGG + Intronic
967538253 3:190632925-190632947 ATAAACAGATGAACAGAGCAGGG - Intronic
967766631 3:193287500-193287522 AGAAATGGAACAACAAAGCATGG + Intronic
968325391 3:197809566-197809588 AAAAAAGACTGAACAGAGCAAGG - Intronic
969802450 4:9579599-9579621 AGAAAATGCTGAAAACAGCAAGG - Intergenic
969824714 4:9748212-9748234 AGGAATGGCAGACCAGAGCGGGG + Intergenic
969872555 4:10113945-10113967 AGAAATGGAGGACCAGATCATGG - Intronic
970758164 4:19451092-19451114 TCACATGGCTGCACAGAGCAGGG + Intergenic
970818769 4:20189249-20189271 AGAAATGGGAGAAAAGAGCCAGG - Intergenic
972349957 4:38227326-38227348 AGAAATGACTGAAAAGATCAAGG + Intergenic
974146060 4:57948953-57948975 AGAAGTGGCTTAAGAGAGCAAGG + Intergenic
977161111 4:93636918-93636940 GGAACTGGCAGAACAGGGCAGGG - Intronic
978020790 4:103809366-103809388 AGAACTTCCTGAACATAGCAAGG - Intergenic
978562793 4:110051388-110051410 AGAAATGGCAGAAGAGCACAAGG + Exonic
978605167 4:110471975-110471997 GGAAATGGCTGAATTGACCAAGG + Intronic
978616491 4:110601935-110601957 AGAAATGGCAGAGTAGAGTAAGG + Intergenic
979053602 4:115968779-115968801 AGAAATGGATAAACAAAGTATGG - Intergenic
979213387 4:118133303-118133325 AGCAAAGCCTGAGCAGAGCATGG + Intronic
979404686 4:120295135-120295157 AGGATTGACAGAACAGAGCAAGG - Intergenic
981600280 4:146480958-146480980 TGAGATGGCTGCACAGAGAAGGG + Intronic
982026743 4:151258985-151259007 AGGAAAGGCTGCACAGGGCATGG + Intronic
982223045 4:153141093-153141115 ATAAAAGGCTGAGGAGAGCATGG - Intergenic
982547722 4:156756170-156756192 ATAAATGGATGAACAAAGTATGG - Intergenic
983379095 4:166968497-166968519 AGCAATGACTAAACAGACCAAGG + Intronic
983699119 4:170569738-170569760 AGAAGTGGCTGAGAAGAGCTGGG - Intergenic
984299445 4:177896053-177896075 AGAAATGGAAGAACAAAGCCTGG + Intronic
984927000 4:184815677-184815699 AGAAATGGCTTAGCAGGACACGG + Intronic
985394174 4:189524632-189524654 AGAAAGTGCTGAACAAAACAGGG - Intergenic
986546709 5:8905764-8905786 AGAGATGGCTTCACAGAGAAAGG - Intergenic
987255162 5:16143123-16143145 AGAAATGAAGGAACAGAGAAAGG - Intronic
987812970 5:22862709-22862731 GTAAATGGATGAACAGAACATGG - Intergenic
988271266 5:29020760-29020782 AGAAATGGCTTGAGAAAGCAGGG - Intergenic
988521974 5:31954456-31954478 AGGAATGGCAGAAAAAAGCAGGG - Intronic
988932720 5:36052682-36052704 AAAAATGGCTTTAGAGAGCAGGG - Intronic
989349526 5:40470372-40470394 AGAAATGGATGAACATTCCATGG - Intergenic
989604700 5:43232781-43232803 TAAACTGGCTGAACAGTGCATGG - Intronic
994253702 5:97567904-97567926 ATAAATGGCTGAAGAGTTCAAGG + Intergenic
994728953 5:103469738-103469760 AGAAATGGTTGAATAAAGAATGG - Intergenic
995097494 5:108255905-108255927 AGAAAATGCTGAACAAAGCAAGG + Intronic
996816966 5:127584790-127584812 AGAAATGGGAGAGCCGAGCATGG - Intergenic
997377128 5:133405271-133405293 AAAACTGGCTGAAAAGAGCAAGG + Intronic
997886975 5:137638874-137638896 AGAACTGGCTGAATAAAACAGGG + Intronic
999187619 5:149724421-149724443 ATAAATGACTGCACAGAGCATGG - Intergenic
999364957 5:151016896-151016918 AGAAATTGCAGAACCGAGCTGGG - Intergenic
999509788 5:152237660-152237682 TGAAATGACTGAACACAGCCTGG - Intergenic
999613934 5:153401847-153401869 AGAAATAGCTGAACATGGTAAGG + Intergenic
1000129400 5:158280918-158280940 AGAAATGAAACAACAGAGCATGG + Intergenic
1000511847 5:162192441-162192463 AGAAATGGCTTGAAAGAGTAGGG + Intergenic
1001694210 5:173657952-173657974 AGAAATTGCTAAACTGATCAAGG - Intergenic
1001970869 5:175953975-175953997 AGAAATGGCACAACAGTGCCTGG - Intronic
1002246569 5:177889789-177889811 AGAAATGGCACAACAGTGCCTGG + Intergenic
1003304916 6:4917669-4917691 AGAAATGGCAGCACTGAGGAAGG + Intronic
1003409767 6:5851767-5851789 AGAGAGGGCTGCACAGTGCAAGG - Intergenic
1003982827 6:11405499-11405521 AGAGATGTCTGCACAGAGCAGGG - Intergenic
1004079468 6:12377016-12377038 ATACATGGCAGGACAGAGCAAGG + Intergenic
1004245834 6:13974186-13974208 TGGAATGGCAGAAAAGAGCATGG - Intronic
1004553088 6:16668702-16668724 CGAAATGCTTGAACAGGGCATGG - Intronic
1005002074 6:21251757-21251779 AGAAATGGCTGATCCTAGGATGG - Intergenic
1005445332 6:25916756-25916778 AGAAATGGCTGAAAAAACCCAGG + Exonic
1007943426 6:45803490-45803512 AGAAATGGCCAGAGAGAGCAGGG - Intergenic
1009035928 6:58117082-58117104 AGAACTTGCTGAACAGCACAAGG + Intergenic
1009187737 6:60594059-60594081 AGAAATGAATGAGCAGAGAAGGG + Intergenic
1011143495 6:84187798-84187820 AGAAATGACTGGAAAGAACAAGG + Intronic
1012094220 6:94937747-94937769 TGAAATTGCTTAACAGATCAAGG - Intergenic
1012257458 6:97050403-97050425 AAAAATGGCTTGAGAGAGCATGG + Intronic
1012549928 6:100456812-100456834 GGAAATGGCTCAACTAAGCACGG - Intronic
1012856522 6:104508372-104508394 GGACATGGCTGAAAATAGCAAGG - Intergenic
1013219993 6:108070020-108070042 AAAAATGACGGAACAGAGCAAGG - Intronic
1014251002 6:119115653-119115675 TCAAATGGCTTAAGAGAGCAGGG + Intronic
1015105516 6:129531961-129531983 AGAAATGAGTAAGCAGAGCACGG + Intergenic
1015482932 6:133734306-133734328 AGGAATGAGTGAGCAGAGCATGG + Intergenic
1016931626 6:149416559-149416581 AGAAATGGAACAACAGAGCCTGG + Intergenic
1017204960 6:151795189-151795211 AAAAATGTCTGAAAAGAGCTGGG + Intronic
1017532063 6:155303791-155303813 AGAAATGGATGTAAAGAGCCTGG - Intronic
1019806593 7:3130914-3130936 AGAAATGGATGACCAGGGCCTGG - Intergenic
1019882311 7:3873510-3873532 AGAAATGGCTGAAAAAATAATGG - Intronic
1020802100 7:12744519-12744541 AGAAATTGAAGAACAGAGCCTGG + Intergenic
1020891053 7:13878154-13878176 AGAAAAGACAGAACAGAGAAGGG - Intergenic
1021156975 7:17221976-17221998 ACAAATGGATGAAGAAAGCATGG + Intergenic
1022770007 7:33459692-33459714 AGAAATGGCTGATTCCAGCAGGG - Intronic
1023673926 7:42610243-42610265 ATAAAAAGCTGAAAAGAGCATGG + Intergenic
1023734982 7:43226826-43226848 ACCAATGACTGAACACAGCAGGG - Intronic
1024960246 7:54967096-54967118 AAACATGGCTGAAAAGAGAAGGG + Intergenic
1025710420 7:63902658-63902680 AGGAATGGCAGAGCAGAGGAGGG - Intergenic
1026431532 7:70352223-70352245 AGAGTTGGCAGAACAGTGCAGGG - Intronic
1026590410 7:71689957-71689979 AGAAATGGAACAACAGAGCTTGG + Intronic
1026945674 7:74314551-74314573 AGATATGGCTGGACAGACAAGGG + Intronic
1030345240 7:108425818-108425840 AGAAATGGCTGGAGAGTTCATGG + Intronic
1031321016 7:120327892-120327914 AGAAAAGGCTCAGCAGAACATGG - Intronic
1033242746 7:139694307-139694329 AGATATGTATCAACAGAGCAAGG + Intronic
1034194052 7:149232480-149232502 AGGAAGGGCTGAACACAGCTAGG - Intergenic
1035657872 8:1324676-1324698 TGAAATGGCTGAAAAGGACATGG - Intergenic
1038202391 8:25425680-25425702 AGAGATGGCTGGACAAAGCAAGG - Intergenic
1038421576 8:27437263-27437285 AGAGAGGGGTGAACAGTGCAGGG + Intronic
1040353440 8:46591553-46591575 AGTAATAACTGAACAGAGGAAGG + Intergenic
1040414317 8:47183095-47183117 AGAAATGGTTCAACCGTGCAGGG - Intergenic
1040683884 8:49847132-49847154 AGAAACGGCTGTACACAGCAGGG + Intergenic
1041333937 8:56758655-56758677 AGAAATAGCTGAACATAGTTTGG - Intergenic
1041746102 8:61210983-61211005 AGGAAGGGATGAAGAGAGCAAGG + Intronic
1042949594 8:74187170-74187192 AGAACTGGCTTCACATAGCAAGG - Intergenic
1043197720 8:77320040-77320062 AGGAATGTATGAACAGAGTATGG - Intergenic
1045960690 8:107964652-107964674 AGAAATGGCTGAACAGAGCAGGG - Intronic
1047419989 8:124699707-124699729 AGAAATAACTCAACTGAGCATGG + Intronic
1047747178 8:127853944-127853966 AGAAAGGGCAGGACAGAGCAAGG - Intergenic
1048077645 8:131090461-131090483 AGAAATGGAAGAACAAAGCCTGG + Intergenic
1049428025 8:142545872-142545894 AGAAAATGCTGCACAGAGCCTGG + Intergenic
1050001664 9:1083890-1083912 ATAAGTGGCTGAACTGTGCAGGG + Intergenic
1050046813 9:1554864-1554886 TGAAATGACTGCAAAGAGCATGG - Intergenic
1050466390 9:5928738-5928760 AGAAATGGCTGATTTGGGCAGGG - Intronic
1051067882 9:13126693-13126715 ATAAAGAGCTTAACAGAGCATGG - Exonic
1051308615 9:15744281-15744303 AGAAATTGCTGAAAAAAACATGG + Exonic
1051720186 9:20028931-20028953 AGAAACGGCTGGACAAAGCCAGG - Intergenic
1053112075 9:35469924-35469946 AGAAAAGGATGATCAGAGTAGGG - Intergenic
1053183138 9:35991644-35991666 AGAAAGAGATGAACAGAACAGGG + Intergenic
1055026803 9:71730579-71730601 AGAAAAGGCAGGATAGAGCAAGG + Intronic
1055373835 9:75627418-75627440 AGAAATGGCTCAGAAGAGCATGG + Intergenic
1055830071 9:80367890-80367912 AGAAAGGGCTAAACAAAGCATGG - Intergenic
1056030615 9:82549515-82549537 AAAAATGGCTTAAAAGAGCAGGG + Intergenic
1058707195 9:107647377-107647399 AGAAATGACTGAACAGCTCTTGG + Intergenic
1062588796 9:137263719-137263741 AGAAAGGGCTGGACGGGGCAAGG - Intronic
1185825384 X:3244267-3244289 ACAAATGGATAAACAGAGGAAGG + Intergenic
1186138008 X:6539974-6539996 AGAAAAGGCTGAATAGAAAATGG + Intergenic
1186881281 X:13868984-13869006 AGCAATGGATGCATAGAGCATGG + Intronic
1189519675 X:41752701-41752723 AAAAATGGCTGAAAGGAGGAGGG + Intronic
1189687688 X:43582675-43582697 AGAAATGGATGAAAAGTACATGG + Intergenic
1189835228 X:45013630-45013652 AGAACAGGATCAACAGAGCAGGG - Intronic
1190259683 X:48790063-48790085 AGAAAAGGATGAACAGAAAAGGG + Intronic
1190574503 X:51819337-51819359 AGAAACGGCTTGACAGAACAAGG - Intronic
1190575634 X:51834357-51834379 AAAAATGGCTTGATAGAGCAAGG - Intronic
1191167245 X:57403798-57403820 ACAAATGTCTGAACAGACCTAGG - Intronic
1192422561 X:71046636-71046658 AGAAATGTCTGAAAACAACAGGG + Intergenic
1192890295 X:75383546-75383568 AGAAAAGGCTTCACAGAGGAGGG - Intronic
1194313859 X:92349423-92349445 AGAAATGACTGAAGAGGTCAAGG - Intronic
1194359771 X:92935441-92935463 ATGAATGGCTGCAGAGAGCATGG + Intergenic
1194740066 X:97562132-97562154 AGAAATGTGTGAACATAGTAAGG + Intronic
1195044343 X:101042771-101042793 AGAAAAGGCTTCCCAGAGCAGGG + Intronic
1196085016 X:111675322-111675344 AGAAATGGCTGGACAGACAGGGG + Intronic
1196307046 X:114115795-114115817 AGAAATGTTTGCAGAGAGCAGGG - Intergenic
1198608191 X:138367891-138367913 AGAAATGGGAGAAGAGAGAATGG + Intergenic
1198624748 X:138558410-138558432 AAAAATGGATGAACAAACCACGG - Intergenic
1198642546 X:138772545-138772567 AAAAATGGATGAAAACAGCATGG - Intronic
1199115614 X:143988641-143988663 AGAAATGGTTGAACAGAGAGGGG - Intergenic
1199307654 X:146286378-146286400 ATATATGGCTTAACACAGCAAGG + Intergenic
1199407196 X:147476374-147476396 AGAAATGGCAGAAGAGCACAAGG - Intergenic
1200237317 X:154473913-154473935 AGAACAGGCTGAAGAGAGCCAGG - Intergenic
1200622128 Y:5463523-5463545 AGAAATGACTGAAGAGGTCAAGG - Intronic
1200667966 Y:6051265-6051287 ATGAATGGCTGCAGAGAGCATGG + Intergenic
1200808911 Y:7461983-7462005 TAAAATGGGTGAGCAGAGCAGGG + Intergenic
1200817985 Y:7553624-7553646 AGAAATTCCTGAGCAGAGAAAGG + Intergenic
1200931892 Y:8704305-8704327 AGAAATCACTGAACATTGCATGG - Intergenic
1201253812 Y:12087763-12087785 ACAAATGGATAAACAGAGGAAGG - Intergenic