ID: 1045960691

View in Genome Browser
Species Human (GRCh38)
Location 8:107964653-107964675
Sequence GAGAAATGGCTGAACAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 321}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045960691_1045960704 14 Left 1045960691 8:107964653-107964675 CCTGCTCTGTTCAGCCATTTCTC 0: 1
1: 0
2: 1
3: 32
4: 321
Right 1045960704 8:107964690-107964712 TCTGCTTTGCAGGGGGTGGGGGG No data
1045960691_1045960703 13 Left 1045960691 8:107964653-107964675 CCTGCTCTGTTCAGCCATTTCTC 0: 1
1: 0
2: 1
3: 32
4: 321
Right 1045960703 8:107964689-107964711 TTCTGCTTTGCAGGGGGTGGGGG No data
1045960691_1045960701 11 Left 1045960691 8:107964653-107964675 CCTGCTCTGTTCAGCCATTTCTC 0: 1
1: 0
2: 1
3: 32
4: 321
Right 1045960701 8:107964687-107964709 TCTTCTGCTTTGCAGGGGGTGGG No data
1045960691_1045960698 6 Left 1045960691 8:107964653-107964675 CCTGCTCTGTTCAGCCATTTCTC 0: 1
1: 0
2: 1
3: 32
4: 321
Right 1045960698 8:107964682-107964704 GTAACTCTTCTGCTTTGCAGGGG No data
1045960691_1045960700 10 Left 1045960691 8:107964653-107964675 CCTGCTCTGTTCAGCCATTTCTC 0: 1
1: 0
2: 1
3: 32
4: 321
Right 1045960700 8:107964686-107964708 CTCTTCTGCTTTGCAGGGGGTGG No data
1045960691_1045960699 7 Left 1045960691 8:107964653-107964675 CCTGCTCTGTTCAGCCATTTCTC 0: 1
1: 0
2: 1
3: 32
4: 321
Right 1045960699 8:107964683-107964705 TAACTCTTCTGCTTTGCAGGGGG No data
1045960691_1045960697 5 Left 1045960691 8:107964653-107964675 CCTGCTCTGTTCAGCCATTTCTC 0: 1
1: 0
2: 1
3: 32
4: 321
Right 1045960697 8:107964681-107964703 GGTAACTCTTCTGCTTTGCAGGG No data
1045960691_1045960696 4 Left 1045960691 8:107964653-107964675 CCTGCTCTGTTCAGCCATTTCTC 0: 1
1: 0
2: 1
3: 32
4: 321
Right 1045960696 8:107964680-107964702 AGGTAACTCTTCTGCTTTGCAGG No data
1045960691_1045960702 12 Left 1045960691 8:107964653-107964675 CCTGCTCTGTTCAGCCATTTCTC 0: 1
1: 0
2: 1
3: 32
4: 321
Right 1045960702 8:107964688-107964710 CTTCTGCTTTGCAGGGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045960691 Original CRISPR GAGAAATGGCTGAACAGAGC AGG (reversed) Intronic
900523324 1:3116559-3116581 GAGGAAGGGCTGAGCAGACCAGG - Intronic
900544238 1:3219701-3219723 GAGCAAGGGCTGAACATGGCAGG + Intronic
901120353 1:6886804-6886826 GAGAAATGAAAGAACAGATCTGG + Intronic
901404014 1:9033946-9033968 GAGAAGCAGCTGAACAGAGAGGG - Intergenic
901674432 1:10874687-10874709 CAGTAATGGCAGAACAGAGCAGG - Intergenic
901957987 1:12801141-12801163 GAGAATTGGTTGAACCCAGCAGG - Intergenic
902274406 1:15328873-15328895 GGGACATGGCTTATCAGAGCAGG + Intronic
902606825 1:17573646-17573668 GAGAAGTGGCTGGACAGCGTGGG - Intronic
902761380 1:18582999-18583021 GAGAGATGGCTGAATGTAGCAGG - Intergenic
904840169 1:33367513-33367535 CAGGAATGGCTGAATAGAACAGG + Intronic
906100160 1:43255221-43255243 CAGAAATGGAGGAGCAGAGCAGG - Intronic
906315244 1:44782796-44782818 GATAAATGCCAGAACAGAGGAGG - Intergenic
906405490 1:45538710-45538732 GAGAAAGTGCTGAACAGGGCCGG + Intergenic
906406040 1:45542889-45542911 GCTGAAGGGCTGAACAGAGCTGG + Intergenic
906950432 1:50330899-50330921 CAGAAAGGGCTGAAAACAGCAGG + Intergenic
907301083 1:53486716-53486738 GAGGCAAGGCTGAAAAGAGCAGG + Intergenic
909346320 1:74591550-74591572 GGGAAATGGGTGAACAAAGTTGG + Intronic
909515422 1:76501908-76501930 CAGAAATTGCTGAACTGATCAGG - Intronic
909942844 1:81631304-81631326 GAGAATTGCCTGAACAGGGGAGG - Intronic
909950571 1:81715001-81715023 AAAAAATGTCTGAACAAAGCAGG - Intronic
911464128 1:98230500-98230522 GATTCATGGCTGAACAGAGAAGG - Intergenic
911652201 1:100402309-100402331 TACAAATATCTGAACAGAGCAGG + Intronic
911941444 1:104052544-104052566 GACACAAGGCTGCACAGAGCAGG + Intergenic
912691766 1:111810074-111810096 CAGAAATGGCAGACAAGAGCTGG - Intronic
913175325 1:116267911-116267933 GAGAAAACGCTGAAAAGAGACGG + Intergenic
915079428 1:153341679-153341701 AAGAAGTGGCTGAACATAACTGG + Exonic
915445942 1:155975030-155975052 GAGAAAAGGCTGAGAGGAGCTGG - Intronic
916072718 1:161180231-161180253 GAGAATTGGCTGAACCCAGGAGG - Intergenic
916365369 1:164020931-164020953 GAGAATTGCCTGAACACAGGAGG + Intergenic
917110692 1:171544211-171544233 GAGAAATGCTTGAACCCAGCGGG - Intronic
919155017 1:193753315-193753337 GAGAAGTGGCCAAACAGATCAGG + Intergenic
919314415 1:195953660-195953682 GAGAAATGCTTGAACACAGGAGG - Intergenic
920754784 1:208718630-208718652 AAGAAATGGCTGAGCACAGAAGG - Intergenic
921254560 1:213327786-213327808 GAGAAATGTCAGAACAAACCTGG - Intergenic
921338300 1:214109822-214109844 GAGATATGACTGAACAAAGTTGG + Intergenic
921773060 1:219066280-219066302 CAGAACTGGCTGATCAGAGGAGG + Intergenic
923513344 1:234672711-234672733 GAGACTTGGCTGAGCAGTGCTGG - Intergenic
924642142 1:245844211-245844233 GAGAAATGGCTGATGAGAACTGG - Intronic
1063567192 10:7180956-7180978 CAGAAAAGGGTGAACACAGCAGG + Intronic
1064004844 10:11691468-11691490 AAGAATTTGCTGAACAGACCTGG + Intergenic
1064206900 10:13332138-13332160 GAGGAATGGCTAAATAAAGCAGG + Intronic
1065003377 10:21357354-21357376 GAGAAATGCCTGCAGAGAGTGGG - Intergenic
1065086731 10:22186140-22186162 TAGAAATGGAGAAACAGAGCTGG - Intergenic
1066092667 10:32040896-32040918 GAGAATTGCCTGAACCGGGCAGG + Intronic
1066444070 10:35465789-35465811 GAGAGATGACTGCACAGAGCAGG - Intronic
1067207850 10:44234712-44234734 GAGAAACAGCTGAACACAGGAGG - Intergenic
1067409008 10:46048437-46048459 GAGAAAGGGATGCTCAGAGCAGG + Intergenic
1067459992 10:46451221-46451243 GAGAAAATGCTGAAGAGACCTGG - Intergenic
1067627197 10:47933392-47933414 GAGAAAATGCTGAAGAGACCTGG + Intergenic
1068010705 10:51446866-51446888 GAGAAATGGCTGCTGAGAGCAGG - Intronic
1070173906 10:73954323-73954345 GAGAAATGCCTGAACCCAGGAGG - Intergenic
1071551422 10:86569034-86569056 GACAAATCCCAGAACAGAGCAGG - Intergenic
1072820556 10:98552420-98552442 GAGAAATGAATGAAAAAAGCGGG + Intronic
1072954676 10:99878027-99878049 GAGAATTGCCTGAACCCAGCAGG + Intronic
1073080801 10:100859463-100859485 GAGAAAGGGGTGAGCAGAGGAGG - Intergenic
1073162636 10:101413231-101413253 GAGAATTGCCTGAACACAGGAGG - Intronic
1074443305 10:113497528-113497550 GAGAAGTGGTAGTACAGAGCTGG - Intergenic
1074846853 10:117406233-117406255 GAGAAATGGTTGAACCCAGGAGG + Intergenic
1074961383 10:118448995-118449017 GAGAAAAGGCAGAAGAGAGGCGG - Intergenic
1076415234 10:130282069-130282091 AAACAATGGCTCAACAGAGCAGG + Intergenic
1076524031 10:131099644-131099666 GAGAAGGGGCTGAGCAGTGCTGG - Intronic
1077695045 11:4386052-4386074 GAGAGATGGCAGGTCAGAGCAGG - Intronic
1078213090 11:9287219-9287241 GAGAAATGCTTGAACCGAGGAGG + Intronic
1078235777 11:9483385-9483407 GAGAACTGCTTGAACTGAGCAGG - Intronic
1081782963 11:45726211-45726233 GAGCAAAGGCTGGAAAGAGCTGG + Intergenic
1081917438 11:46741683-46741705 GAGAATTGGCTGAACTCAGGAGG + Intergenic
1083836573 11:65272922-65272944 GAGAATTGCTTGAACAGAGGCGG + Intronic
1084616683 11:70240991-70241013 GTGAAATGGGTGAAGAGGGCAGG - Intergenic
1085243117 11:75075015-75075037 GAGAAAAGGCTGATGACAGCAGG - Intergenic
1085246799 11:75108530-75108552 GAGAAAAGGCTGATGACAGCAGG - Intronic
1085264050 11:75225915-75225937 CAGAAATGGAAGAAGAGAGCAGG - Intergenic
1085297230 11:75438080-75438102 GATGGATGGATGAACAGAGCAGG + Intronic
1086452435 11:86930493-86930515 GAAGAATGGCTGACCAGGGCCGG + Intronic
1087018657 11:93579886-93579908 GAGAATGGGCAGAAAAGAGCAGG + Intergenic
1089899898 11:121970069-121970091 AAGAAATGCCTGCAAAGAGCAGG + Intergenic
1091144189 11:133262931-133262953 GAGAAATACCTAAAGAGAGCTGG + Intronic
1093927125 12:24920075-24920097 GAGAAATGGAAGCACAGAGAGGG - Intronic
1094749219 12:33386108-33386130 GAGAATTGCTTGAACAGAGGTGG - Intronic
1098213537 12:68191656-68191678 AAAAAAAGGCTGATCAGAGCTGG - Intergenic
1100958547 12:99936754-99936776 AAGTAATGGCTGAAAATAGCGGG - Intronic
1101574321 12:105983433-105983455 GAGAAATGGCGGAACAAACATGG + Intergenic
1102324375 12:111966767-111966789 GAGAAATGGCTCAGTACAGCTGG - Intronic
1102577000 12:113861988-113862010 GAGAAATGGCTACAGTGAGCAGG + Intronic
1102980948 12:117240892-117240914 GAGAGATGGATGGACAGAGCCGG - Intronic
1103644784 12:122382614-122382636 GAGAATTGGCTGAACCCAGGAGG + Intronic
1103902854 12:124312172-124312194 GGGAAACGGCTGAATAGACCTGG - Intronic
1104000547 12:124857225-124857247 GGGAAATGGATGCACAGAGGCGG - Intronic
1104294537 12:127500037-127500059 TAGGAATGGCTGAGCAGGGCTGG - Intergenic
1104913870 12:132254109-132254131 GAGAATTGCTTGAACAGAGGAGG - Intronic
1106754266 13:32806577-32806599 GTGAAATGGCTGATGAGACCTGG + Intergenic
1108339225 13:49480587-49480609 GAGAAATGGCTGCCCAAAGTAGG - Intronic
1109532100 13:63663513-63663535 GAGCAATGGCTGAAGAGTACAGG - Intergenic
1109650710 13:65321748-65321770 GAGAAATGCTTGAACACAGGAGG + Intergenic
1112676899 13:101711947-101711969 GAGAAATGGTTCAACTCAGCTGG - Exonic
1113247561 13:108415082-108415104 GAGAACTCCTTGAACAGAGCTGG + Intergenic
1113910820 13:113840396-113840418 GAGAAAGGGCAGAACACACCTGG - Intronic
1118811167 14:69275110-69275132 GAGAAAGGGGTGACCATAGCAGG + Intronic
1118953563 14:70458012-70458034 GAGATGTGGCTTAACAGAGAAGG + Exonic
1119213529 14:72850544-72850566 GTGCAGTGACTGAACAGAGCAGG - Intronic
1119549257 14:75496562-75496584 GAGAAAAGGCTTCACAGAGGAGG + Intergenic
1119737207 14:76990801-76990823 AAGAAATTGCTGAACCTAGCCGG + Intergenic
1120166280 14:81204739-81204761 TAGAAATGGCTAAACAGAAAAGG - Intronic
1120745639 14:88148574-88148596 GAGAATTGGATGAAAGGAGCAGG - Intergenic
1120813568 14:88829757-88829779 GAGAAATGGCTGAAAATGACTGG + Intronic
1122958603 14:105084148-105084170 GAGGAATGGATGGATAGAGCTGG - Intergenic
1124001687 15:25765644-25765666 GAGAATTGGCTGTCCAGGGCTGG - Intronic
1125869032 15:43080859-43080881 GAGAAATGCATGAACACAGGAGG + Intronic
1127979471 15:64024144-64024166 GAGGAATTGCTGCACAGAGAAGG - Intronic
1128509512 15:68304715-68304737 GAGAAAGAGCTGGAAAGAGCAGG - Intronic
1129781577 15:78275461-78275483 GAGAAATGGCTAATCAGAAAGGG + Intronic
1130869002 15:87955611-87955633 GAGAAGAGGATGAAGAGAGCTGG + Intronic
1131132975 15:89912114-89912136 TAGAAACGGCAGAACAGACCAGG - Intronic
1131184031 15:90260130-90260152 GAAAAATGGTTGAACAGTACTGG + Intronic
1131816371 15:96225161-96225183 GAGACATAGATGAACACAGCTGG + Intergenic
1131968613 15:97870902-97870924 GTGGAATGGCTGAACAGAATTGG + Intergenic
1133402524 16:5499089-5499111 GAGAAATGGAAAACCAGAGCCGG - Intergenic
1136548812 16:30970772-30970794 GAGATGGAGCTGAACAGAGCAGG - Intronic
1137410504 16:48223827-48223849 GAGAAATGGCTGAGCAACTCTGG - Intronic
1139348722 16:66322017-66322039 GAGAAGTGGCTGCTCAGGGCGGG - Intergenic
1139659922 16:68413785-68413807 GAGCATGGGCTGTACAGAGCAGG + Intronic
1139834390 16:69826480-69826502 GAGAATTGGCTGAACCCAGGAGG + Intronic
1141155721 16:81595476-81595498 GAGAACTGCTTGAACAGGGCAGG - Intronic
1141236169 16:82219378-82219400 AAGAAATTGCTGAAGAGAACTGG - Intergenic
1141302790 16:82833627-82833649 GACAGATGGAAGAACAGAGCGGG - Intronic
1141505255 16:84472618-84472640 GAGAATTGCTTGAACATAGCAGG + Intergenic
1141690302 16:85592963-85592985 CAGAGCTGGCTGAACAGAGGTGG - Intergenic
1142523756 17:523211-523233 GAGAAATGGCTGAAGACAGAAGG + Intronic
1142908767 17:3069126-3069148 GAGGAATGGCTGATCAGAGATGG + Intergenic
1142925800 17:3235119-3235141 GAGGAATGGCTGATCAGAGATGG - Intergenic
1143354369 17:6314584-6314606 CAGAAGTGGCTCAAGAGAGCTGG - Intergenic
1144507460 17:15844808-15844830 GAGAAAGGCCTGGCCAGAGCTGG + Intergenic
1145119326 17:20242701-20242723 GAGAAATGCGTGGCCAGAGCTGG + Intronic
1145171586 17:20662414-20662436 GAGAAAGGCCTGGCCAGAGCTGG + Intergenic
1146393753 17:32445018-32445040 GGGAAATGCCTGTCCAGAGCTGG - Intronic
1146890733 17:36504952-36504974 GAGAAATGGCTGCACTGTGCGGG + Intronic
1147361596 17:39934132-39934154 GAGAAAGGGCTGAACTGGTCAGG + Intergenic
1147433835 17:40393964-40393986 GAGAATTGCCTGAACCTAGCAGG + Intronic
1147908920 17:43842921-43842943 GAGAAAAGGAAGAAGAGAGCCGG - Intergenic
1150240623 17:63629210-63629232 GAGAATTGCCTGAACACAGGAGG - Intronic
1152173652 17:78771348-78771370 GAGAAATGCCTGAACCCAGGAGG + Intronic
1153178989 18:2411615-2411637 GAGTATTGGCAGAAAAGAGCAGG - Intergenic
1155101473 18:22614402-22614424 GAGAATTGCTTGAACAAAGCAGG + Intergenic
1158768917 18:60491103-60491125 GAGAAATGGCCTAACAGAAGTGG - Intergenic
1158828786 18:61255143-61255165 GATTCATGGCTGAATAGAGCTGG - Intergenic
1160187726 18:76688473-76688495 CAGCCATGGCTGAACAAAGCAGG + Intergenic
1160505599 18:79424887-79424909 GAGAAATGGAGAAACAGAGATGG - Intronic
1161199142 19:3004938-3004960 GTGAACAGGCTGGACAGAGCTGG - Intronic
1161395338 19:4042481-4042503 CAGCAATGGCTGCACTGAGCCGG - Intergenic
1161460823 19:4396307-4396329 GAGAATTGCTTGAACAGAGGAGG + Intronic
1162051292 19:8035327-8035349 GAGAAATGCTTGAACCCAGCAGG - Intronic
1162842548 19:13366993-13367015 GAGAAATGGCAGAACTAGGCAGG + Intronic
1163587508 19:18172181-18172203 AATAAATGGCTGATCAGAGAGGG - Intronic
1164032540 19:21420839-21420861 GAGAATTGCCTGAACAAAGGAGG - Intronic
1168210978 19:54889781-54889803 CAGATGTGGCTGAACCGAGCTGG + Exonic
925118426 2:1399143-1399165 GAGGGATGGCTGAACAGAGGAGG - Intronic
925121897 2:1425343-1425365 GAAAAATGACTGCACAGAACGGG - Intronic
925439208 2:3869135-3869157 AAGAAATGGCTGATCAGGTCAGG - Intergenic
925640999 2:5985773-5985795 GACAAATGGCTCTGCAGAGCTGG - Intergenic
925944799 2:8850915-8850937 CAGTAATGGCTGAAAACAGCTGG + Intergenic
927119362 2:19940811-19940833 CAGAAATGGCTGGACAGCACAGG - Intronic
927195883 2:20546580-20546602 GAGTAATGGCTGATCTGAGGTGG + Intergenic
927663891 2:25016085-25016107 AAGAAAGGGCTGAAGAGAGAGGG + Intergenic
927670243 2:25062882-25062904 CAGACATGGCTGAGCAGGGCTGG + Intronic
927872580 2:26633002-26633024 GAGAGTTGGCTACACAGAGCAGG - Intronic
927915470 2:26933343-26933365 TAGACTTGGCTGGACAGAGCAGG + Intronic
929011484 2:37449626-37449648 GAGAAATCTTTGAGCAGAGCTGG + Intergenic
929763190 2:44822949-44822971 TAGAAATGGCTTTACAGAGCAGG - Intergenic
929967355 2:46545126-46545148 GAGAACTGGCTGTACTGACCTGG - Intronic
931305693 2:61026055-61026077 GAGAAACGCCTGAAAAGATCTGG + Intronic
931421079 2:62128236-62128258 GAGAATTGCTTGAACACAGCAGG + Intronic
934786095 2:97007733-97007755 GAGAATTGCTTGAACAGAGGTGG - Intronic
934985894 2:98884291-98884313 GAGAAAGGGCTCAACACAGAAGG + Intronic
935847488 2:107182458-107182480 GAGGAATAGATGAACAGAGAAGG + Intergenic
938622605 2:133072172-133072194 GAGAATTGCTTGAACAGAGGAGG - Intronic
939806794 2:146783892-146783914 GAGCAATGGCTGAAAACAGTGGG - Intergenic
941863020 2:170304761-170304783 GAAAAATGGATGAAAAGGGCCGG - Intronic
942126092 2:172827228-172827250 TAAAAATGGATTAACAGAGCCGG - Intronic
944906064 2:204263362-204263384 GAGAATTGGCTGCAAAGGGCAGG + Intergenic
945904605 2:215577257-215577279 GAGAATTGCCTGAACCGAGGAGG + Intergenic
946202163 2:218076712-218076734 GAGAAAGGGATGCACAGAGGAGG - Intronic
946210236 2:218141963-218141985 GAGTTATGGCTGGAGAGAGCTGG + Intergenic
946216288 2:218186329-218186351 AAGAAATGACTTAGCAGAGCAGG + Intergenic
946455255 2:219820489-219820511 GAGAAAGACCTGAACACAGCAGG - Intergenic
947666651 2:231910289-231910311 CAGAAATGGCTGCTCAGGGCTGG - Intergenic
948341207 2:237253720-237253742 GAGAGATGACTGATCAGAGCTGG - Intergenic
1168971888 20:1936996-1937018 GAGAAATGGGTGAAGACTGCAGG + Intronic
1169560433 20:6794040-6794062 GAAAAAAGGCTGAAAAGAGGTGG + Intergenic
1169691527 20:8337979-8338001 GAGACAAGGATGAACAGAGAGGG + Intronic
1172651405 20:36505075-36505097 GAGAATTGCCTGAACCCAGCAGG - Intronic
1172864400 20:38084636-38084658 GACAATTTGCTGAAGAGAGCAGG - Intronic
1173873482 20:46355961-46355983 GCGAAATGACCAAACAGAGCTGG + Intronic
1174551474 20:51365767-51365789 GAGACTTGGCTGGACAGAGATGG - Intergenic
1174626563 20:51919887-51919909 GACATACAGCTGAACAGAGCTGG - Intergenic
1175496870 20:59420664-59420686 AAGACATGGCTGGATAGAGCAGG + Intergenic
1176419437 21:6502289-6502311 GAGAACTGCCTGAACTGAGGAGG - Intergenic
1178085469 21:29107223-29107245 GAGAATTGCCTGAACACAGGAGG + Intronic
1178848133 21:36190692-36190714 GAGAAATAGATGAACTGAGGTGG - Intronic
1179694930 21:43110612-43110634 GAGAACTGCCTGAACTGAGGAGG - Intergenic
1180643792 22:17320794-17320816 GAGAAACGGGTGGACACAGCAGG + Intergenic
1181490772 22:23259604-23259626 GAGAATTGCCTGAACACAGGAGG - Intronic
1182031346 22:27161691-27161713 GAGAAAAGGGAGAACAGAGGAGG + Intergenic
1182081456 22:27532124-27532146 GAGACATGGATGAACACAGCTGG + Intergenic
1183009828 22:34935705-34935727 GAGAGTGGGATGAACAGAGCTGG - Intergenic
1184077521 22:42191842-42191864 GAGAAAAGGCTGAACCCAGCAGG + Intronic
1184878802 22:47292067-47292089 GAGCTATCTCTGAACAGAGCTGG - Intergenic
949211011 3:1501323-1501345 GAGAAAGGGCTGAACAGAATAGG + Intergenic
949213135 3:1530023-1530045 CAGAAATAGCTGAACAGAACTGG - Intergenic
949374016 3:3366793-3366815 GAGACATGGCTGCAGAGACCAGG + Intergenic
949789572 3:7778293-7778315 TAGAAATGGATGCACAGAGGGGG + Intergenic
949995911 3:9617100-9617122 AAGAAATGGTTGAACAGATCTGG - Intergenic
950284341 3:11733086-11733108 GAGAAATGCCTGAACCCAGGAGG - Intergenic
952212827 3:31246788-31246810 GAGAAAAGGCAGAAAACAGCTGG + Intergenic
953238533 3:41127264-41127286 GAGAAAGAGCTGAGCAGAGCTGG - Intergenic
955963808 3:64367411-64367433 GAGCAATAGCTGAACAGAGAAGG - Intronic
956658035 3:71570891-71570913 GGGAAATGGCAGAGCACAGCTGG + Intronic
957260256 3:77892756-77892778 GAGAAATGGGAGATGAGAGCAGG - Intergenic
957836977 3:85607363-85607385 GAGAAATGGGTAAACTAAGCAGG + Intronic
959621146 3:108399679-108399701 GAAAAATGTCTGAACAAGGCAGG + Intronic
959679052 3:109071975-109071997 GAGAAAAGGGTTAACATAGCAGG - Intronic
960156449 3:114301446-114301468 GAGAAATGATTGAATAGAGGGGG + Intronic
960735535 3:120775423-120775445 AAAAAATAGCTGGACAGAGCGGG + Intronic
963629784 3:147718818-147718840 GAGAATTGCCTGAACCCAGCAGG - Intergenic
964864978 3:161247697-161247719 GAGAATTGCCTGAACCGAGGAGG + Intronic
966039052 3:175458138-175458160 GAGAATTGGCTGATAACAGCTGG - Intronic
966843870 3:184111182-184111204 CACAAATGCCTGAACAGCGCTGG - Intergenic
967106868 3:186261232-186261254 TAGAAATTGCTGAACAGCACAGG - Intronic
967538254 3:190632926-190632948 GATAAACAGATGAACAGAGCAGG - Intronic
968183210 3:196612545-196612567 GATAAAAGGCAAAACAGAGCTGG - Intergenic
969824713 4:9748211-9748233 GAGGAATGGCAGACCAGAGCGGG + Intergenic
970054338 4:11953600-11953622 GAGAATTGCTTGAACAGAGGAGG - Intergenic
970113603 4:12668159-12668181 GAGAATTGCCTGAACCGAGGAGG - Intergenic
970758163 4:19451091-19451113 GTCACATGGCTGCACAGAGCAGG + Intergenic
971774629 4:30946795-30946817 GAGAAATGCTTGAACACAGGAGG - Intronic
972340041 4:38144405-38144427 GAGAAATACCTGAACAGTTCTGG - Intergenic
975271591 4:72441704-72441726 GGGAAAAGGCTAAACAGAGCTGG + Intronic
975464429 4:74693320-74693342 GGGAAATGTCTGACCAGAGAAGG + Intergenic
975995502 4:80309202-80309224 GAGAAATGACTGAACCCAGGAGG - Intronic
976962625 4:90997923-90997945 CAGAAATGCCTTTACAGAGCTGG - Intronic
977145021 4:93428921-93428943 GAGCAAAGGATGAACAGAGTAGG + Intronic
979762632 4:124425902-124425924 GAGAACTGGCTGAACTCAGTAGG - Intergenic
979932991 4:126655720-126655742 GAGAATTGCTTGAACACAGCGGG - Intergenic
981246836 4:142550419-142550441 GAGAAGTGGCTCAAGAGGGCAGG + Intronic
982302786 4:153897364-153897386 GAGATCCGGCTGAACACAGCAGG + Intergenic
982369422 4:154618437-154618459 TAGAAATGGCTTAACATATCAGG - Intergenic
983048657 4:163017740-163017762 GAGACATGGCTGATCACAGATGG + Intergenic
983657114 4:170094146-170094168 GAGAAATGGCCCATCAGGGCAGG + Intergenic
983699120 4:170569739-170569761 GAGAAGTGGCTGAGAAGAGCTGG - Intergenic
983880804 4:172930186-172930208 GAGAATTGCCTGAACACAGGAGG + Intronic
984774765 4:183471871-183471893 GAGAATTGCCTGAACCCAGCAGG + Intergenic
985394175 4:189524633-189524655 GAGAAAGTGCTGAACAAAACAGG - Intergenic
987022508 5:13889431-13889453 CAGAAAGGGGTGAACACAGCAGG + Intronic
988285427 5:29209736-29209758 GAGTAATGTCTGAACATAGGTGG - Intergenic
988381124 5:30498156-30498178 GAGAAGTGGCAGAAGAGAGTGGG - Intergenic
988521975 5:31954457-31954479 GAGGAATGGCAGAAAAAAGCAGG - Intronic
988721275 5:33881493-33881515 GAGAAATGGAAGAACAGTGAGGG + Intronic
988932721 5:36052683-36052705 GAAAAATGGCTTTAGAGAGCAGG - Intronic
989224989 5:39016446-39016468 GAGAAAGGGCAGAAGAGAGTGGG + Intronic
989547947 5:42696389-42696411 GAGGAAGGGCTGCACAGAGATGG + Intronic
990005029 5:50935825-50935847 GAAAAATAGCTGAACTGATCTGG + Intergenic
990475706 5:56159911-56159933 GAGAAATGGCTCAAAATAACAGG + Intronic
990587519 5:57226647-57226669 GAGAACTGCCTGAACCCAGCAGG - Intronic
990952124 5:61308943-61308965 GGGAGATGGCTGACAAGAGCAGG + Intergenic
991038006 5:62147246-62147268 GAGAAATGTCAAATCAGAGCTGG + Intergenic
997327851 5:133036820-133036842 GAGAATTGCCTGAACCCAGCAGG + Intergenic
997477987 5:134159468-134159490 GAGAATTGGCTGAACCTAGGAGG - Intronic
997705184 5:135943838-135943860 AAGAAATAGCTTAACAGAGATGG + Intronic
998411902 5:141917594-141917616 GAGACAAGGCTGAAAAGTGCAGG + Intergenic
999217169 5:149944950-149944972 AAGAGATGTCTGCACAGAGCAGG + Intergenic
999364958 5:151016897-151016919 GAGAAATTGCAGAACCGAGCTGG - Intergenic
1000204598 5:159046875-159046897 GTGATATCACTGAACAGAGCTGG + Intronic
1001974043 5:175982132-175982154 GAGAAATGCTTGAACCGAGGAGG + Intronic
1003523876 6:6882508-6882530 GAGAAAAGGAGGAAAAGAGCAGG - Intergenic
1003679034 6:8233822-8233844 GAGAATTGCCTGAACTCAGCAGG + Intergenic
1003982828 6:11405500-11405522 GAGAGATGTCTGCACAGAGCAGG - Intergenic
1008201412 6:48595304-48595326 GAGAGAATGCTGAACAGAGTAGG - Intergenic
1009168342 6:60367777-60367799 GAGAAAAGGCTGAACAGCATGGG - Intergenic
1010895530 6:81358522-81358544 GAGAAATGGCTGAAGCAAGGCGG - Intergenic
1011770054 6:90665759-90665781 GAGAATTGGCTGAACTCAGGAGG - Intergenic
1013366568 6:109441878-109441900 AAAAAATAGCTGATCAGAGCTGG + Intronic
1013541180 6:111111054-111111076 AACAAATGGCTGTACAGAACTGG - Intronic
1013846956 6:114464518-114464540 GAGAAATTGCTTCACAGAGAAGG + Intergenic
1015646734 6:135399538-135399560 GAGGAATGGCTGGACATAGCAGG - Intronic
1017204959 6:151795188-151795210 TAAAAATGTCTGAAAAGAGCTGG + Intronic
1018601205 6:165543679-165543701 GAGAGAGGGCTGGAAAGAGCGGG + Intronic
1019450894 7:1097253-1097275 GAGAAATGGCTGATTTGGGCCGG + Intronic
1019511683 7:1420784-1420806 GAGAATTGGTTGAACCCAGCGGG + Intergenic
1020036226 7:4964758-4964780 GAGAAAGCGCTCAAAAGAGCCGG + Intergenic
1020649206 7:10854848-10854870 GAGAGGTGGCTGAAGACAGCTGG + Intergenic
1020891054 7:13878155-13878177 GAGAAAAGACAGAACAGAGAAGG - Intergenic
1022038468 7:26556617-26556639 GAAAACAGGCTGAACAGAACTGG + Intergenic
1022378198 7:29834975-29834997 GAGAAATGGCTGAGCCAGGCTGG - Intronic
1022522380 7:31016567-31016589 GAGAATTGGATGAACAGTGGTGG - Intergenic
1022770008 7:33459693-33459715 GAGAAATGGCTGATTCCAGCAGG - Intronic
1023653274 7:42392427-42392449 GAGAATTGCTTGAACACAGCAGG - Intergenic
1023734983 7:43226827-43226849 GACCAATGACTGAACACAGCAGG - Intronic
1026103290 7:67400392-67400414 GAGAAGTGCCTGAACTCAGCAGG - Intergenic
1026508518 7:71007392-71007414 GAGAAATGGCTGGAAAGACAGGG + Intergenic
1026785624 7:73300164-73300186 GAAAAAGGCCTGAACAGAGGAGG + Intergenic
1027503032 7:78979265-78979287 GAGAAATGGCTGATTGGGGCAGG + Intronic
1028348413 7:89813117-89813139 CAGAAATGGTTGAACAGAGAAGG - Intergenic
1029608257 7:101612950-101612972 GAAAACTGGCTGCAAAGAGCTGG - Intergenic
1030175046 7:106643817-106643839 CAGAGATGGCTGAACAGATGGGG + Intergenic
1032496704 7:132368335-132368357 GAGACATGGGGGAAGAGAGCTGG + Intronic
1033673213 7:143512345-143512367 TAGAAATGACAGAACAGGGCAGG - Intergenic
1034279107 7:149839051-149839073 AAGAAAGGGCTGAAAAGAGAGGG + Intronic
1034766092 7:153722576-153722598 GAGAATTGCTTGAACAGAGGAGG + Intergenic
1034962134 7:155369413-155369435 GAGAAAGGCCTGATCAGTGCTGG - Intergenic
1035938621 8:3870542-3870564 GAGAAATGGCTGGACATTTCTGG - Intronic
1036577325 8:10040335-10040357 GAGAAATGGTTGAACCGAGAAGG - Intergenic
1038170564 8:25128048-25128070 GAGAAATGGATGAATTGAACTGG + Intergenic
1039152818 8:34526127-34526149 GTAAAAGGGCAGAACAGAGCTGG - Intergenic
1040683883 8:49847131-49847153 AAGAAACGGCTGTACACAGCAGG + Intergenic
1041003969 8:53481461-53481483 CAGGAATGGCTGGACAGAGCAGG + Intergenic
1041401566 8:57450721-57450743 GAGAAATGCCAGGACAGAACAGG + Intergenic
1042866598 8:73362267-73362289 GAGAAAGAGATGAGCAGAGCAGG - Intergenic
1042924792 8:73955673-73955695 GAGAATTGCCTGAACCCAGCAGG + Intronic
1043367241 8:79547435-79547457 GAGAATTGGCTGAACCCAGGAGG + Intergenic
1043982132 8:86655417-86655439 GAGGAAATGCTGAACAGAGTGGG - Intronic
1045960691 8:107964653-107964675 GAGAAATGGCTGAACAGAGCAGG - Intronic
1046212603 8:111097815-111097837 GAGAAATGCTTGAACCGAGGAGG + Intergenic
1048442202 8:134468410-134468432 GAGTAATGGCAGCACAGAGTAGG + Intergenic
1053179611 9:35957446-35957468 GAGAAAGAGATGAACAGAACCGG + Exonic
1053183137 9:35991643-35991665 GAGAAAGAGATGAACAGAACAGG + Intergenic
1053184412 9:36003213-36003235 GAGAAAGAGATGAACAGAACCGG + Intergenic
1053316713 9:37058379-37058401 GAGAAGAGGCTGAAGAGACCAGG - Intergenic
1054841863 9:69750780-69750802 AAGCAATGGCTGAACAGAGATGG - Exonic
1056030614 9:82549514-82549536 AAAAAATGGCTTAAAAGAGCAGG + Intergenic
1056350096 9:85741437-85741459 GAGAAAGGGCTGAGCAGAAAGGG + Intronic
1056820231 9:89836249-89836271 TAGACATGGGTGAACAGCGCTGG - Intergenic
1057078293 9:92152677-92152699 GAGAAGGGGCTGAGCAGTGCTGG - Intergenic
1058028972 9:100174991-100175013 GCCAAAGGGCTGAACTGAGCTGG + Intronic
1058212271 9:102183935-102183957 AAGAAATGGCTGTTCAGAGTTGG + Intergenic
1059355675 9:113697719-113697741 GAGAATGGGCTCAACAGGGCTGG - Intergenic
1061454246 9:130685765-130685787 GAGAATTGCTTGAACTGAGCAGG - Intergenic
1062354740 9:136156650-136156672 GACAGATTGCTGAACAGAGCGGG - Intergenic
1062659872 9:137624403-137624425 GAGAATTGCCTGAACCGGGCAGG - Intronic
1185699995 X:2223601-2223623 GAGGAAGGACAGAACAGAGCAGG + Intronic
1186180103 X:6965330-6965352 GAGAAATGGTTCAACAGACATGG + Intergenic
1186483812 X:9917608-9917630 GAGAACTGGCTGAACCCAGGAGG - Intronic
1187626298 X:21117836-21117858 CAAAAATGGCTCCACAGAGCAGG - Intergenic
1189300163 X:39946778-39946800 GAGTAATGGCAGAACAGAAAGGG + Intergenic
1189454360 X:41171591-41171613 GAGAAATGGTTTAATAGAACAGG + Intronic
1189519674 X:41752700-41752722 GAAAAATGGCTGAAAGGAGGAGG + Intronic
1190098138 X:47499234-47499256 TAGAAAGGGATTAACAGAGCAGG + Intergenic
1190259682 X:48790062-48790084 GAGAAAAGGATGAACAGAAAAGG + Intronic
1192314517 X:70041604-70041626 AAGAAAGGGCAGAAAAGAGCTGG + Exonic
1192344097 X:70287131-70287153 AAGAAAAGGAGGAACAGAGCAGG + Intronic
1192736600 X:73855267-73855289 GATAAATGGCAGAAGAGGGCAGG - Intergenic
1195699034 X:107688551-107688573 GAGAGAAGGCTGGACAGAGCAGG + Intergenic
1196085015 X:111675321-111675343 CAGAAATGGCTGGACAGACAGGG + Intronic
1196810831 X:119627887-119627909 GAGAATTGCCTGAACTGAGGAGG - Intronic
1199115615 X:143988642-143988664 GAGAAATGGTTGAACAGAGAGGG - Intergenic
1199186683 X:144923400-144923422 GGGAAAGGCCTGAACATAGCTGG + Intergenic
1200375803 X:155778769-155778791 GAGAAAGGGATGCACAGAGAGGG + Exonic
1201162148 Y:11174396-11174418 GAGAATTGCTTGAACCGAGCAGG - Intergenic