ID: 1045960694

View in Genome Browser
Species Human (GRCh38)
Location 8:107964667-107964689
Sequence AGAGTTACCTCCTGGAGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 177}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045960694_1045960702 -2 Left 1045960694 8:107964667-107964689 CCATTTCTCCAGGAGGTAACTCT 0: 1
1: 0
2: 2
3: 15
4: 177
Right 1045960702 8:107964688-107964710 CTTCTGCTTTGCAGGGGGTGGGG No data
1045960694_1045960696 -10 Left 1045960694 8:107964667-107964689 CCATTTCTCCAGGAGGTAACTCT 0: 1
1: 0
2: 2
3: 15
4: 177
Right 1045960696 8:107964680-107964702 AGGTAACTCTTCTGCTTTGCAGG No data
1045960694_1045960703 -1 Left 1045960694 8:107964667-107964689 CCATTTCTCCAGGAGGTAACTCT 0: 1
1: 0
2: 2
3: 15
4: 177
Right 1045960703 8:107964689-107964711 TTCTGCTTTGCAGGGGGTGGGGG No data
1045960694_1045960698 -8 Left 1045960694 8:107964667-107964689 CCATTTCTCCAGGAGGTAACTCT 0: 1
1: 0
2: 2
3: 15
4: 177
Right 1045960698 8:107964682-107964704 GTAACTCTTCTGCTTTGCAGGGG No data
1045960694_1045960697 -9 Left 1045960694 8:107964667-107964689 CCATTTCTCCAGGAGGTAACTCT 0: 1
1: 0
2: 2
3: 15
4: 177
Right 1045960697 8:107964681-107964703 GGTAACTCTTCTGCTTTGCAGGG No data
1045960694_1045960704 0 Left 1045960694 8:107964667-107964689 CCATTTCTCCAGGAGGTAACTCT 0: 1
1: 0
2: 2
3: 15
4: 177
Right 1045960704 8:107964690-107964712 TCTGCTTTGCAGGGGGTGGGGGG No data
1045960694_1045960700 -4 Left 1045960694 8:107964667-107964689 CCATTTCTCCAGGAGGTAACTCT 0: 1
1: 0
2: 2
3: 15
4: 177
Right 1045960700 8:107964686-107964708 CTCTTCTGCTTTGCAGGGGGTGG No data
1045960694_1045960701 -3 Left 1045960694 8:107964667-107964689 CCATTTCTCCAGGAGGTAACTCT 0: 1
1: 0
2: 2
3: 15
4: 177
Right 1045960701 8:107964687-107964709 TCTTCTGCTTTGCAGGGGGTGGG No data
1045960694_1045960699 -7 Left 1045960694 8:107964667-107964689 CCATTTCTCCAGGAGGTAACTCT 0: 1
1: 0
2: 2
3: 15
4: 177
Right 1045960699 8:107964683-107964705 TAACTCTTCTGCTTTGCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045960694 Original CRISPR AGAGTTACCTCCTGGAGAAA TGG (reversed) Intronic
901429775 1:9206424-9206446 AGAATTAGCTCTTGAAGAAAGGG - Intergenic
902805470 1:18858891-18858913 AGAGTGACCTCTTGCAGAGAGGG - Intronic
905769576 1:40628915-40628937 AGGTTTACCTGCTGGAGAATGGG - Exonic
905818738 1:40972911-40972933 ACAGTTACATCATGGAGAATGGG + Intergenic
905979628 1:42211871-42211893 AAAGTTACATCCTGGAGTACTGG + Intronic
910740847 1:90514571-90514593 TGAGATATCTCCTGGAGTAATGG - Intergenic
913323806 1:117608708-117608730 GGAGTTACCTACTAAAGAAATGG + Intronic
915261888 1:154682704-154682726 AAATTTAACTCCTGGAGAGAAGG - Intergenic
916318037 1:163472243-163472265 AGAGCTCCCTCCTGGGGCAAAGG - Intergenic
916858695 1:168779282-168779304 AGAGATACATCATAGAGAAAAGG - Intergenic
917658898 1:177157731-177157753 AGTGTTACCTCTTGTGGAAAGGG - Intronic
917955508 1:180092926-180092948 AGATTTACCTTCTTTAGAAAAGG - Exonic
921162822 1:212485183-212485205 AGAATTCCCTACTGGAGAACAGG - Intergenic
922585320 1:226730003-226730025 ATAGTTTACTCCTGGAAAAATGG + Intronic
923461301 1:234211676-234211698 TTAGTTACTTCCTGGATAAATGG - Intronic
1062827443 10:582938-582960 AGTGTTACCTCTTGGGAAAATGG + Intronic
1063757531 10:9031551-9031573 AGAGATAGCAACTGGAGAAAAGG + Intergenic
1064112729 10:12552567-12552589 AGAGGTTCCTCCTACAGAAAAGG - Intronic
1065938182 10:30540079-30540101 AGTGTTCCCTTCTGGAGCAAAGG + Intergenic
1066284522 10:33951541-33951563 CGAGTTACATCCAGGATAAATGG + Intergenic
1066400178 10:35068470-35068492 GTAGTTAGCTCCTAGAGAAACGG + Intronic
1068505896 10:57898622-57898644 AGAGACAGGTCCTGGAGAAATGG - Intergenic
1071228838 10:83562677-83562699 AGAGGTGGCTCCTGGAGCAAAGG + Intergenic
1071751987 10:88489644-88489666 ACAGATACCTCCTGCAGAGAGGG + Intronic
1072824454 10:98592194-98592216 AGATTTACCTGGTGTAGAAAAGG - Intronic
1075255954 10:120926349-120926371 AGAGCTGCCTCCAGGAGAGAAGG - Intergenic
1076148477 10:128143933-128143955 AGATTAACCACCTGGACAAAAGG + Intergenic
1078870122 11:15335725-15335747 ATATCTACCTCCTGGATAAAAGG + Intergenic
1080573912 11:33580947-33580969 TGAGTGACCACCTGAAGAAAGGG + Intronic
1080693779 11:34583329-34583351 AGGATTATCTCCTGGAGACAGGG - Intergenic
1081557181 11:44175597-44175619 AGAGTTACTTCCTGCTGAAGGGG - Intronic
1083148456 11:60775352-60775374 AACGTTAGCGCCTGGAGAAATGG + Intronic
1083363659 11:62128582-62128604 AGGGCTTCCTCCTGGAGACACGG - Intronic
1083464376 11:62835372-62835394 AAAGCAGCCTCCTGGAGAAATGG - Intronic
1084371733 11:68749966-68749988 AGAATTCCCTCCAGGGGAAAGGG + Intronic
1087345181 11:96963062-96963084 AGAGTTAGCTGGAGGAGAAATGG + Intergenic
1088008203 11:104967932-104967954 AGAGTTAAGTCCTGGAGGGAAGG + Intronic
1088017603 11:105079809-105079831 AGAGTTAAGTCCTGGAGAGAGGG + Intronic
1088020169 11:105109790-105109812 AGAGTTAAGTCCTGGAGAGAGGG + Intergenic
1089384162 11:118057119-118057141 ATAGCTACCTGCTGGAGAAAGGG + Intergenic
1094419479 12:30255599-30255621 AGAGTAACCTAGAGGAGAAAAGG + Intergenic
1094428632 12:30342044-30342066 AGAGTAACCTAGAGGAGAAAAGG - Intergenic
1099141004 12:78975179-78975201 AGAGGAACCTCATGGAGAACTGG - Intronic
1104020054 12:124986290-124986312 AGAGCTACCTCAAGGAGAATGGG - Intronic
1104703790 12:130927505-130927527 AGAGTTCCTTCTTGGAAAAATGG + Intergenic
1108385661 13:49897063-49897085 AGAGTAACCTGGGGGAGAAATGG + Intergenic
1109250898 13:60019840-60019862 AGATTTACCTCCTGGCCAAAAGG + Intronic
1110176598 13:72563696-72563718 AGTATCACCTCCTGGAGAAAAGG - Intergenic
1112074832 13:95900827-95900849 TAAATTACGTCCTGGAGAAATGG - Exonic
1112669331 13:101616192-101616214 GAAGTTTGCTCCTGGAGAAAGGG + Intronic
1114667152 14:24385559-24385581 AGCTGCACCTCCTGGAGAAAGGG - Intergenic
1115025676 14:28742679-28742701 AGACTTAATTCATGGAGAAAGGG + Intergenic
1115178742 14:30597064-30597086 TGAGTTACCTCATCTAGAAATGG - Intronic
1117308684 14:54500944-54500966 AATGTTACTTCCAGGAGAAAAGG - Intergenic
1117424290 14:55579773-55579795 AGAGAGATCCCCTGGAGAAAGGG + Intronic
1121380073 14:93457404-93457426 TTAGTTACCTACTGGGGAAATGG + Intronic
1126010339 15:44296656-44296678 AGAGTCCCATCCTGGAAAAAAGG - Intronic
1126358514 15:47821725-47821747 TGATTTGGCTCCTGGAGAAAAGG - Intergenic
1126575371 15:50191459-50191481 AGAGTTACCTCCTAAATTAAGGG - Intronic
1129988312 15:79938102-79938124 GTAGTTATCTCCTGGAGGAAGGG - Intergenic
1131316142 15:91339519-91339541 ACAGTTTCCTCCTGGAGATGTGG + Intergenic
1131351183 15:91701394-91701416 AGTGTTACCCCCTGAAGGAAGGG + Intergenic
1131555998 15:93399446-93399468 GTAGTTACCTCTGGGAGAAAGGG - Intergenic
1137039832 16:35600208-35600230 ATTTTTACCTCCTGCAGAAAGGG + Intergenic
1137473990 16:48790786-48790808 AGAGTTTCCTCCTGGATAGAGGG - Intergenic
1138766730 16:59614108-59614130 GGAGTTAAATCTTGGAGAAAGGG + Intergenic
1140071419 16:71653659-71653681 AGAGAAATTTCCTGGAGAAATGG - Intronic
1140556603 16:75928509-75928531 ATTGTAACCTCCTGGAGAAGAGG + Intergenic
1141383389 16:83596498-83596520 AAAATTTCCTCCTGGAGAAAGGG + Intronic
1142647253 17:1322515-1322537 ATATTTGCTTCCTGGAGAAAGGG - Intergenic
1146933887 17:36797976-36797998 ATGGTTCCCTCTTGGAGAAAGGG - Intergenic
1148033531 17:44640035-44640057 AGGGTTGCCTCCTGGAGAAAGGG - Intergenic
1148514346 17:48201937-48201959 TTATTTATCTCCTGGAGAAATGG + Intronic
1148598919 17:48879310-48879332 ATGGTGACCTCCTGGAGAACAGG - Intergenic
1148877345 17:50697873-50697895 AGAGTTACTTCCAGGAAAAAAGG + Intronic
1151664277 17:75536492-75536514 AGAGGTACCCCCTAGAGACACGG - Intronic
1157001735 18:43535294-43535316 AGAGGAACCTCTTGGGGAAAGGG + Intergenic
1158252581 18:55506030-55506052 AGAGACACCTCTTTGAGAAATGG + Intronic
1158973786 18:62692395-62692417 AGGGCTGCCTCCTGGAGAGAAGG - Intergenic
1160272850 18:77403581-77403603 ACAGCACCCTCCTGGAGAAAGGG + Intergenic
1161614399 19:5261881-5261903 AAAGTTACACCCTGGAGAACTGG + Intronic
1162604567 19:11696708-11696730 AGAGTTTCCTGCTGGCAAAAAGG - Intergenic
1162659511 19:12157944-12157966 TGGGATGCCTCCTGGAGAAAGGG + Intergenic
1163136934 19:15318700-15318722 TCAGTTACCTTCTGGAGCAAAGG + Intronic
1163225198 19:15955678-15955700 AGAGCAACCTCCTGGACACAGGG + Intergenic
1166926264 19:46270723-46270745 CGAGTTAACTCCTTGAGGAAGGG + Intergenic
1167536001 19:50051933-50051955 AGCTTTACTTCCTGCAGAAAGGG - Intronic
926416941 2:12658679-12658701 AGAGTTGCATCTGGGAGAAAGGG + Intergenic
926437319 2:12851400-12851422 ATAAGTACCTCATGGAGAAAGGG - Intergenic
926997743 2:18756538-18756560 TGACTTATCTCCTAGAGAAAAGG + Intergenic
927454246 2:23235802-23235824 AGGGTCACTTCCTGGAGAAAAGG + Intergenic
928196814 2:29222207-29222229 GGAGTCTCCTACTGGAGAAAAGG + Intronic
929275168 2:40017340-40017362 TGAGTCTCCTCTTGGAGAAATGG - Intergenic
931957255 2:67441114-67441136 AGAGTGAGTACCTGGAGAAAGGG - Intergenic
932411841 2:71552188-71552210 ACAGCTACCTCCTGGACACAAGG - Intronic
933171496 2:79130785-79130807 AGATTCACCTCCTGGAAACATGG - Intergenic
933406674 2:81868688-81868710 ATTTTTACCTCCTGCAGAAAGGG - Intergenic
935325194 2:101929325-101929347 AGAGCTGCCTCCTGGAGATCGGG - Intergenic
935651474 2:105385924-105385946 AGAGTTGGTTCCTGGATAAATGG - Intronic
936106100 2:109625893-109625915 ATGGTTACCTCCGGGAGAAGGGG + Intergenic
937332770 2:121042606-121042628 AGAGGAACCTTCTGGAGAAGAGG + Intergenic
938250405 2:129811443-129811465 AGCATCACCTCCTGGAGAAAGGG - Intergenic
939629052 2:144513101-144513123 GGAGGCACCTCCTGGAGAAGGGG + Intronic
940736221 2:157455822-157455844 AGAGTAACCTCATTTAGAAATGG + Intronic
940867841 2:158834904-158834926 ATAGTTACCCCTTGGAGAATGGG + Intronic
943986464 2:194626648-194626670 AGGGTTACCTCATGCAGAAATGG - Intergenic
944122394 2:196254151-196254173 AGAATTACCTGCAAGAGAAAGGG - Intronic
945194951 2:207228880-207228902 TGATTTTCCTCCTGGATAAAAGG + Intergenic
949049172 2:241888156-241888178 AGTGGGACCTCATGGAGAAAGGG - Intergenic
1169951374 20:11047751-11047773 AGAGTTAAGTCCTGGAAAAATGG + Intergenic
1172057808 20:32166356-32166378 AGCGGTACCTCCTGAGGAAAGGG - Exonic
1173174927 20:40757331-40757353 TCAGTTTCCTCCTGAAGAAAAGG - Intergenic
1173178566 20:40784026-40784048 AGAATTGCTTCCTGGAGAGAAGG - Intergenic
1180392535 22:12297640-12297662 ACAGTGACCTCCTGGGGTAAGGG - Intergenic
1180407213 22:12567128-12567150 ACAGTGACCTCCTGGGGTAAGGG + Intergenic
1182697750 22:32207938-32207960 ACAGTCACATCCTGGAGGAACGG + Intergenic
1183818509 22:40324254-40324276 GGAGGTACCTCTTGGAGCAACGG + Exonic
949108935 3:235281-235303 AAAGCTCCATCCTGGAGAAATGG + Intronic
949563259 3:5221983-5222005 AGGGTTCTCTGCTGGAGAAATGG - Intergenic
950866232 3:16191314-16191336 AGAGGTACCTCTTGTAGTAATGG + Intronic
955251515 3:57287611-57287633 AGAATTACCTCATGGAGCAGGGG - Intronic
955456025 3:59122644-59122666 AGTGTTACCCTCTGGAGAAGTGG - Intergenic
956252014 3:67244406-67244428 AGAATTACCTCCAGGACATATGG + Intergenic
958796353 3:98710258-98710280 AGAGTTATCTCCTTAAGAAAGGG - Intergenic
960731377 3:120731404-120731426 AGACTTACCTTTTGGAAAAAAGG + Intronic
962692533 3:137914193-137914215 AGAGTTACCTTTTGGGGAGAGGG - Intergenic
963056550 3:141190996-141191018 ATAGTGAGCTCCTGGAGAACAGG - Intergenic
968463125 4:735812-735834 AGAGTTGCCTTCTCCAGAAATGG - Intronic
970556697 4:17241011-17241033 AGAGTTAGGTCCTTAAGAAAAGG - Intergenic
970566859 4:17340067-17340089 AAAGCTACATGCTGGAGAAACGG + Intergenic
970898967 4:21136580-21136602 AGAGGTACCTAATGGAGGAATGG - Intronic
971059957 4:22956799-22956821 AGACTTACCACGTAGAGAAAAGG + Intergenic
971630912 4:28992754-28992776 AGTGTTACCTCTTTGAGACAAGG - Intergenic
972153988 4:36133960-36133982 AAAGTTACAGCCTGGAGATAGGG - Intronic
973730537 4:53818189-53818211 AGAGTTGGCTTCTGAAGAAAAGG + Intronic
976534736 4:86198200-86198222 AGTGTCTCCTTCTGGAGAAAAGG + Intronic
977471658 4:97450989-97451011 AGAATTACCTTCTGGAGGCAGGG + Intronic
979083722 4:116378777-116378799 AGAGATACTTCATTGAGAAATGG + Intergenic
979789213 4:124757078-124757100 AGATTTTCCTCCTTGATAAATGG - Intergenic
980188146 4:129489005-129489027 ATTGTAACCTCTTGGAGAAATGG + Intergenic
982455712 4:155607206-155607228 GGTGCTACCTGCTGGAGAAAGGG - Intergenic
984914883 4:184713725-184713747 AGACTGAGTTCCTGGAGAAAGGG + Intronic
985940580 5:3132589-3132611 AGAGAAACCGCCTGGAGAGAAGG - Intergenic
988311065 5:29557328-29557350 AGAATTTCCTTCTGGGGAAATGG - Intergenic
989571984 5:42953526-42953548 AGAGTTACATCCCGCAGAAGAGG - Intergenic
993865458 5:93189238-93189260 AGAGATAACTCCCAGAGAAAAGG + Intergenic
994099354 5:95877187-95877209 AATGTTACCTCCTGTAAAAAGGG + Intergenic
995141085 5:108736105-108736127 AGTGTTACCTTCTGAAGAGAGGG + Intergenic
995168885 5:109082612-109082634 AGTTTTACCTCTTAGAGAAAGGG + Intronic
995642106 5:114268605-114268627 AGAGGTGCCTCCTGGGGAGATGG + Intergenic
998923523 5:147097420-147097442 AGGGTTACCAACTGGGGAAATGG - Intergenic
1000200870 5:159009574-159009596 ATAGTTATCTCCTGGATAACAGG - Intronic
1001638368 5:173228770-173228792 AGGCTGAGCTCCTGGAGAAAGGG - Intergenic
1004883128 6:20028173-20028195 CGAGTTAGCTCCTGGAGGACTGG - Intergenic
1006734882 6:36266494-36266516 AGATTTCCCTCCTTGATAAAAGG - Intronic
1012357312 6:98331462-98331484 AGATTAACGACCTGGAGAAATGG + Intergenic
1013266894 6:108508634-108508656 AGAGTTAGGTTCTGGAGAAGTGG - Intronic
1016211337 6:141538791-141538813 ACAGTTGCCTCCAGGAAAAATGG + Intergenic
1017331474 6:153203115-153203137 AAAGTAACCTCCTTGAGAACAGG - Intergenic
1019370383 7:660124-660146 ACAGTTCCCTCCTGCAGAGAGGG + Intronic
1019922348 7:4171129-4171151 AGGGGTGCCTGCTGGAGAAAGGG + Intronic
1022408617 7:30118153-30118175 CGAGATGCCTCCTGGAGAGAAGG + Intronic
1026908048 7:74074522-74074544 AGAGTTACCTCATGGAAAAAGGG + Intergenic
1028243594 7:88449861-88449883 AGAGTTAACTCTTTCAGAAAGGG - Intergenic
1029571204 7:101370832-101370854 AGAGAGACTTCCTGGAGGAAGGG - Intronic
1029975217 7:104827203-104827225 AGAGGTACCACATGGAGAACTGG - Intronic
1031041484 7:116842961-116842983 AGTGTTACATGTTGGAGAAATGG - Intronic
1034202166 7:149289546-149289568 AGAGGTTCCTCCTTCAGAAAAGG + Intronic
1034336132 7:150324710-150324732 AGAGAAGCTTCCTGGAGAAAGGG - Intronic
1034781311 7:153885282-153885304 AGTGTTCCCTTCTTGAGAAAAGG + Intergenic
1035556666 8:572280-572302 AGAGGCACCTTCTAGAGAAAAGG + Intergenic
1036455234 8:8900904-8900926 AGAGGTACCAGCTGGAGACAGGG + Intergenic
1036597377 8:10226132-10226154 ACAGTCACCTGCTGTAGAAATGG - Intronic
1036716839 8:11133423-11133445 AGATCTGCCTCCTGGAGAGAGGG + Intronic
1037965714 8:23132262-23132284 AAAGTCCCCTCCTGGACAAAAGG - Intergenic
1039004819 8:33023031-33023053 ATTTTTACCTCCTGCAGAAAGGG - Intergenic
1044208563 8:89521876-89521898 AAAGATACCTGCTGGAGAAGGGG + Intergenic
1044214411 8:89591818-89591840 AGAGTTGATCCCTGGAGAAAAGG - Intergenic
1045960694 8:107964667-107964689 AGAGTTACCTCCTGGAGAAATGG - Intronic
1048182019 8:132204192-132204214 AGAGTCACCTCCTGTTTAAAAGG - Intronic
1050444894 9:5710425-5710447 AGGGATCCTTCCTGGAGAAATGG + Intronic
1050594513 9:7192704-7192726 AGGGAGACTTCCTGGAGAAAAGG + Intergenic
1051829957 9:21265221-21265243 AGAGTTTCCTCATGGAGATGTGG - Intergenic
1052695424 9:31871448-31871470 ACAATTCCCTCCTGGAGAAGGGG - Intergenic
1053299372 9:36937715-36937737 AGAATGACCTCCTATAGAAAAGG + Intronic
1055769147 9:79698128-79698150 CGTCTTACCTACTGGAGAAATGG + Intronic
1056356324 9:85805132-85805154 AGAACCACCTGCTGGAGAAAGGG - Intergenic
1058397153 9:104567809-104567831 AGAGTAACCTCGTTGAGAAAAGG - Intergenic
1060403004 9:123358993-123359015 GGAGTTACCTCCTGAAGTGAGGG - Intronic
1062682644 9:137790220-137790242 AGTTTTTCCTCATGGAGAAAAGG + Intronic
1186593874 X:10960005-10960027 AGAGTTACCTTCTTGAGAGCAGG - Intergenic
1192505581 X:71680138-71680160 AGAGATGCCTCCGGGAGACAGGG + Intergenic
1192882293 X:75298688-75298710 AGAGCTTCCTCCTAGAAAAAAGG - Intronic
1197095877 X:122594580-122594602 AGACTGACCTCCTTGAGAAAGGG - Intergenic
1197399918 X:125977742-125977764 AGAGACACCTGCTTGAGAAAAGG + Intergenic