ID: 1045960695

View in Genome Browser
Species Human (GRCh38)
Location 8:107964675-107964697
Sequence AAAGCAGAAGAGTTACCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 167}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045960695_1045960704 -8 Left 1045960695 8:107964675-107964697 CCAGGAGGTAACTCTTCTGCTTT 0: 1
1: 0
2: 1
3: 15
4: 167
Right 1045960704 8:107964690-107964712 TCTGCTTTGCAGGGGGTGGGGGG No data
1045960695_1045960702 -10 Left 1045960695 8:107964675-107964697 CCAGGAGGTAACTCTTCTGCTTT 0: 1
1: 0
2: 1
3: 15
4: 167
Right 1045960702 8:107964688-107964710 CTTCTGCTTTGCAGGGGGTGGGG No data
1045960695_1045960703 -9 Left 1045960695 8:107964675-107964697 CCAGGAGGTAACTCTTCTGCTTT 0: 1
1: 0
2: 1
3: 15
4: 167
Right 1045960703 8:107964689-107964711 TTCTGCTTTGCAGGGGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045960695 Original CRISPR AAAGCAGAAGAGTTACCTCC TGG (reversed) Intronic
900874112 1:5329428-5329450 AAAGCAGAAGAGTTATCAACAGG - Intergenic
901035829 1:6335541-6335563 AAAGCAGAAGAGCAAACTGCAGG + Intronic
901250800 1:7777930-7777952 AAAGCAGATAAGTTACCTTCAGG + Intronic
901416573 1:9120629-9120651 AAAGCTGCAGAGTGACCTCGTGG - Intronic
903267875 1:22169106-22169128 AAAGCAGAATAGTGGCCTGCGGG - Intergenic
904233255 1:29095192-29095214 GAAACACAAGAGTTCCCTCCTGG - Intronic
904937122 1:34139277-34139299 GAAGAAGAAGAGAGACCTCCTGG + Intronic
907468915 1:54658982-54659004 AAATCAGAATTGTCACCTCCGGG - Intronic
907743217 1:57187037-57187059 AAAGCAGAAACTTTACCTCCTGG - Intronic
907967253 1:59344475-59344497 ACAGCAGAATGGTTACCTGCAGG - Intronic
909599221 1:77443508-77443530 AAAGAAGAAGAAATACTTCCTGG - Intronic
911784364 1:101926553-101926575 AAACCAGAAGCATTAGCTCCAGG - Intronic
914339150 1:146743464-146743486 AAAGCTGAATAGTTTCCACCAGG - Intergenic
915918719 1:159958286-159958308 AAATCTGAACAGTTACCTTCTGG - Intergenic
916066354 1:161139106-161139128 AAAGCAGAAGAGTAAAGCCCTGG - Intergenic
916486248 1:165261842-165261864 AAAGTAGAACAGTTGCTTCCAGG + Intronic
916564092 1:165958253-165958275 AAAGCAAAATACTTACTTCCTGG + Intergenic
921161805 1:212478140-212478162 AAAGCAGATGAGTTAACGTCAGG + Intergenic
921219916 1:212966099-212966121 AAAGCACAAGAGTTAATTCCTGG - Intronic
921985164 1:221304833-221304855 AAAGCAGAGGTGTTACCTAGGGG + Intergenic
922998875 1:229989254-229989276 AACACAGAAGAGTTACTTCTTGG + Intergenic
1063872608 10:10434906-10434928 ATAGCAGATAAGTTAACTCCTGG + Intergenic
1064546591 10:16456644-16456666 AAAGCAGTAGAGGTACCCGCAGG + Intronic
1065290846 10:24227863-24227885 AAACCAGAAGAATGACCTCTTGG - Intronic
1070602294 10:77874155-77874177 ACAGCAGATGAGTAACCTCCAGG - Intronic
1071328940 10:84541778-84541800 AAATGAGAAGCGTTTCCTCCTGG + Intergenic
1073754647 10:106568161-106568183 AAGGCAGAAGAGTTATTTCTAGG - Intergenic
1075094593 10:119462550-119462572 AAAGGAAAAAAGTTACCTACAGG + Intergenic
1079143938 11:17833867-17833889 AAAGCAAATTAGTTACTTCCTGG - Intronic
1079328254 11:19512542-19512564 AATGCAGAACAGTTACCTTGTGG - Intronic
1080946648 11:36981566-36981588 AAAGCAAATTAGTTACTTCCTGG + Intergenic
1081139645 11:39483002-39483024 AAAACAGAAGAATTCCCTCATGG - Intergenic
1081310841 11:41569931-41569953 AAAGCAGAAAAGTTTTATCCAGG + Intergenic
1082250314 11:49971634-49971656 AAGGCTGAAAAGTTACCTACTGG + Intergenic
1085072432 11:73559601-73559623 AAAGCAGATTAGTTGCCGCCAGG + Intronic
1085362173 11:75899460-75899482 AAAGCAGGAGAACTACCTCATGG - Intronic
1086671835 11:89557359-89557381 AAAGGAGAAGTTTTTCCTCCGGG + Intergenic
1088616098 11:111630291-111630313 AAAGCTGGAAAGTTGCCTCCAGG + Intronic
1088708562 11:112485418-112485440 AAAGCAAAAGATTTCCCTCTGGG - Intergenic
1091597282 12:1886602-1886624 AAGGAACAAGCGTTACCTCCAGG - Intronic
1092582439 12:9858160-9858182 AAAGCAGAAGATATAATTCCTGG + Intronic
1096045343 12:48557289-48557311 AATGCAGAGGAGTTTGCTCCTGG + Intergenic
1097818744 12:64105085-64105107 AAAGCAGAAGAGATAAAGCCAGG - Intronic
1098338013 12:69423393-69423415 AAAACAGAAGAGGAACATCCTGG + Intergenic
1098743080 12:74200085-74200107 AAAGCAAATTAGTTACTTCCTGG + Intergenic
1098897017 12:76075057-76075079 AAAGCAGATGTGTTATATCCAGG + Intronic
1099104373 12:78481150-78481172 AAAGCAGAAAATTAACCTTCAGG + Intergenic
1099506067 12:83477548-83477570 AAAACATAAGAGACACCTCCTGG + Intergenic
1099735082 12:86557221-86557243 AAAGCAGCAGAGTTATCCTCAGG + Intronic
1102094804 12:110229469-110229491 AAAGGCGAAGAGTTAACTGCGGG - Intergenic
1106435981 13:29723022-29723044 AAAGCAAAAGACTCACCTCTTGG - Intergenic
1109536508 13:63729074-63729096 AAAGCAGAAGCGTTGCTTCCTGG - Intergenic
1113195512 13:107799761-107799783 AAAGCAAAAGAGCAACCTCGGGG + Intronic
1113357116 13:109591465-109591487 CAAGCAGAAGAGTGACCTCATGG + Intergenic
1116934359 14:50723546-50723568 AGAGAAGAAAAATTACCTCCTGG - Intronic
1117049978 14:51850120-51850142 AAAGCAGCATAGTTGCCTCTTGG + Intronic
1121852907 14:97238802-97238824 AAACCAGCAGAGTTTCCTCCAGG + Intergenic
1122114066 14:99518915-99518937 AAAGCCCTAGTGTTACCTCCAGG + Intronic
1124892192 15:33743609-33743631 TAGGGAGAAGAGTCACCTCCAGG + Intronic
1124993225 15:34696426-34696448 AGAGAAGAAAAGTAACCTCCCGG + Intergenic
1125515280 15:40315645-40315667 AAAGAAGAGGAGTCACTTCCTGG - Intergenic
1125616155 15:41015597-41015619 AAGGGAGCAGAGTTAGCTCCTGG - Intronic
1130608516 15:85339216-85339238 AAAGTGGAAGAGTTAGCTTCTGG - Intergenic
1130675111 15:85945575-85945597 AAAGTATAATAGTTGCCTCCTGG - Intergenic
1132804321 16:1768672-1768694 AAAGCAGCAGAGTGACGGCCAGG - Intronic
1133453076 16:5919793-5919815 AAAGTAGATGAGTAACTTCCAGG - Intergenic
1134352318 16:13449422-13449444 AAGTCAGAAGAGTAACTTCCTGG + Intergenic
1134829559 16:17312210-17312232 ACAGCAGATGAGTCACCCCCTGG - Intronic
1138109259 16:54310642-54310664 AAAGCAGAATGGTGACCACCAGG + Intergenic
1139995128 16:70973888-70973910 AAAGCTGAATAGTTTCCACCAGG + Exonic
1140703236 16:77601927-77601949 AGATCAGATGTGTTACCTCCAGG - Intergenic
1141234444 16:82202528-82202550 GAAGCAGAAGTGTTACTTTCTGG - Intergenic
1145245423 17:21265992-21266014 AAAGCAGAAGACTTAGCCCAGGG - Intergenic
1146761942 17:35486880-35486902 GAGGCAGAAGAGCTACCTCCTGG + Intronic
1151496734 17:74462599-74462621 AAAGCAGAGAAGTTATTTCCAGG + Intergenic
1151545911 17:74792896-74792918 CAAGCATAAGCGTTTCCTCCTGG + Intronic
1151563425 17:74883237-74883259 ACTGCAGAAGAGTCACCTCTAGG - Intronic
1155358789 18:24979993-24980015 AAAGCAGAAGAGACACCAGCAGG + Intergenic
1155579835 18:27290993-27291015 AAAGTAGAACAGTTACTGCCAGG + Intergenic
1157334840 18:46730190-46730212 CAAGCAGATGACTCACCTCCAGG + Intronic
1168055029 19:53858679-53858701 AAAGCAGAAGAGCCACGACCTGG + Intergenic
1168217410 19:54936439-54936461 AAAGCAGAAGAGATTCCACTTGG + Intronic
1168472577 19:56651421-56651443 AAAGAAAAAGAGTTACTTTCCGG + Intronic
925320795 2:2966125-2966147 GAAGCAGAAGATTTAGGTCCTGG - Intergenic
925908408 2:8554172-8554194 AAAGCAAAAAAGAGACCTCCAGG + Intergenic
927474164 2:23399895-23399917 TTAGCAGTAGAGTTAACTCCAGG - Intronic
929869616 2:45747382-45747404 AAAGTAGAAGAGTGGCTTCCAGG - Intronic
930202823 2:48560945-48560967 AAGGCAGAAAAGTTCCCTCATGG - Intronic
940567081 2:155379081-155379103 AAAGCAAAATAGTTTTCTCCAGG + Intergenic
940717804 2:157247382-157247404 AAAGCAGATGGGTTACCATCAGG - Intergenic
940920619 2:159302204-159302226 AAAGTAGAATAGTTATTTCCAGG + Intergenic
943000033 2:182315534-182315556 AAAAAAGAAGAGTTACTTCTGGG + Intronic
944277257 2:197853040-197853062 AAAGCAGAATAGTGGCCACCAGG - Intronic
944940121 2:204615802-204615824 AAAGTATGAGAGTTACCTTCAGG - Intronic
945268341 2:207913420-207913442 AAAGCAGAAGAGCCAGCACCAGG + Intronic
947352521 2:229261340-229261362 AAAGCAAAATAGCTACCACCAGG + Intronic
1169607925 20:7343856-7343878 AAAGTAGAAGAGGGAGCTCCGGG + Intergenic
1169753497 20:9019839-9019861 AAAGGAGAAAAGTGATCTCCTGG - Intergenic
1170570166 20:17628123-17628145 AGGGCAGAAGAGTCACCCCCTGG - Intronic
1171369118 20:24649221-24649243 AAAGCAGAACTGTTACTTCCAGG - Intronic
1172132202 20:32663537-32663559 ATAGCACCATAGTTACCTCCGGG + Intergenic
1173492092 20:43491258-43491280 AAAGCAGATCAGTTACCTTCAGG - Intergenic
1174751242 20:53113275-53113297 AAAGGAGAAAATTTCCCTCCAGG - Intronic
1178756045 21:35350772-35350794 AAAGGACAAGAGGTAACTCCAGG - Intronic
1179405218 21:41120379-41120401 AAAGGACATGGGTTACCTCCAGG + Intergenic
1179985332 21:44917836-44917858 AGTGCAGAAGAGTTAGCCCCAGG - Intronic
951197140 3:19836726-19836748 ATAGCTGAAGTGTTACCTGCTGG + Intergenic
951970139 3:28434839-28434861 AAAGCAAAAGAATGATCTCCAGG - Intronic
952251920 3:31664063-31664085 CAGGCGGCAGAGTTACCTCCTGG + Exonic
952414560 3:33079154-33079176 AAATCAGAATAGTTAACTCTGGG + Intronic
958130783 3:89419299-89419321 AAAGCAGAGGAGAGACTTCCTGG + Exonic
960986753 3:123285976-123285998 AAAGCAGCACAGTTAGCACCTGG + Intronic
962828974 3:139123168-139123190 AAACAACAAGAGTTACCTTCAGG - Intronic
963465620 3:145677769-145677791 AAAGCAGAAGAGGGTCCTACTGG + Intergenic
963973046 3:151450594-151450616 CAATCATAAGAGTTGCCTCCTGG + Intronic
965597947 3:170426106-170426128 AAAGAAGATGAGGCACCTCCTGG + Intronic
969245197 4:5927382-5927404 AAAGCAAGAGAGTAAGCTCCAGG - Intronic
969922387 4:10552572-10552594 CAAGCAGATGAGTTACTTCTGGG - Intronic
970151564 4:13095734-13095756 AAAGCAGAATAATAACCTCAGGG + Intergenic
970176523 4:13345274-13345296 TAAACAGTAGAGTTACCTACAGG - Intergenic
974450222 4:62045826-62045848 AAAATAAAAGAGCTACCTCCTGG + Intronic
975681883 4:76885576-76885598 AAAGCATAAGAGTTTCTTTCAGG + Intergenic
976127928 4:81853856-81853878 AAAGCAAATTAGTTACTTCCTGG + Intronic
978959978 4:114665042-114665064 GAAGCAGAAGAGGTACTTTCTGG - Intronic
979073504 4:116241260-116241282 AAGGCAGAAGAGTTCCCTCCTGG + Intergenic
979684457 4:123496238-123496260 AAACCAGAAGAGCTACCTAAAGG + Intergenic
980201219 4:129658324-129658346 AAAGCAGGTTAGTTACTTCCTGG + Intergenic
980937889 4:139243469-139243491 ATGGCATAAGAGTTGCCTCCAGG + Intergenic
983388612 4:167100363-167100385 AAAGTGGAAGAGATACCTTCAGG - Intronic
986611139 5:9568487-9568509 AAAAAAGAACAGTTTCCTCCTGG + Intergenic
986767602 5:10941707-10941729 AGAGAAAAAGAGTAACCTCCTGG - Intergenic
987447495 5:18038421-18038443 AAAGCAGCAGAGTTCTCTTCAGG - Intergenic
987853585 5:23388593-23388615 GAAGCAGAAGAATTTCCTCCTGG + Intergenic
988283105 5:29175232-29175254 AAAGAAGAAGAGTAATATCCTGG + Intergenic
988687429 5:33538596-33538618 AAAGAAGAAGAGTTATCCACTGG - Intronic
989818907 5:45770159-45770181 AAACCAGAAAAGTTACAACCAGG + Intergenic
990115970 5:52391196-52391218 CAAGCAGAATAGTTACGTCGGGG - Intergenic
991464343 5:66894428-66894450 AAAACAAAAGAGTTATCACCAGG - Intronic
992934645 5:81688600-81688622 AAAGAATAAGAGTTTCCACCAGG + Intronic
993044249 5:82849316-82849338 AAAGGAGTAGGGTTACCTCTGGG - Intergenic
995179425 5:109216928-109216950 AAATCAGAACAGTTCCCTCTTGG + Intergenic
997337072 5:133115951-133115973 AAAGAAGAATAGGTCCCTCCCGG + Intergenic
999143032 5:149375247-149375269 AAAGCAGACAAGTTCCCTCCTGG + Intronic
999784772 5:154881158-154881180 AAAGCAGAAAATTAACCTCTGGG + Intergenic
1000293786 5:159895336-159895358 AAAGCAGAAGAGCAGCCACCAGG + Intergenic
1002368078 5:178729092-178729114 AAAGCAGAAGGGGTTCTTCCTGG - Intronic
1002385248 5:178860956-178860978 AAAGCAGAAGGGGTTCTTCCTGG + Intronic
1007980940 6:46157637-46157659 AAAGCAGAAGGGTTTTCCCCAGG + Intergenic
1008077369 6:47159225-47159247 AAAGAAGAGGAGGTAGCTCCAGG + Intergenic
1009856228 6:69267865-69267887 AAAGCATCAGATTTCCCTCCCGG + Intronic
1009894257 6:69727566-69727588 AAAGTTGAAAAGTTACCTACTGG + Intronic
1010474785 6:76274250-76274272 AAATAACAAGAGTTTCCTCCTGG - Intergenic
1012049114 6:94317238-94317260 AAAGCAAAAGAGGTGCCACCTGG + Intergenic
1017292156 6:152750919-152750941 AAACCAGAACAGTCAGCTCCGGG + Exonic
1023768373 7:43532660-43532682 AAAGAAAAAGAGTGAGCTCCTGG - Intronic
1023915804 7:44588260-44588282 AAAGTAGAATGGTTACCTGCGGG + Intergenic
1025836832 7:65102309-65102331 CAAACTGAAGATTTACCTCCAGG - Intergenic
1025906611 7:65791745-65791767 CAAACTGAAGATTTACCTCCAGG - Intergenic
1028365352 7:90022808-90022830 AAAGAAGAAGAGTCTCCACCTGG + Intergenic
1028718201 7:93998860-93998882 AAAGCAGAAGAGCTACTTGGGGG + Intronic
1028984403 7:96998469-96998491 AGATCAGAAGAGTTAACCCCAGG + Intergenic
1031655793 7:124353229-124353251 AAGGCAGAAGAATTATCTCCTGG + Intergenic
1032053254 7:128662981-128663003 AAAGCAGGTTAGTTACTTCCTGG - Intergenic
1033830562 7:145246615-145246637 AAAAGAGAAGAGTAACCTCATGG - Intergenic
1034893174 7:154858326-154858348 AAAGCAGAGGAGTTGCATCTCGG + Intronic
1034990595 7:155545482-155545504 AAAGCAGAATAGTCCTCTCCTGG - Intergenic
1037638164 8:20719262-20719284 AAATCAGAACAGTAACTTCCTGG + Intergenic
1039948561 8:42150639-42150661 AAGGCAGAAGAGTTAACTATAGG - Intergenic
1045960695 8:107964675-107964697 AAAGCAGAAGAGTTACCTCCTGG - Intronic
1048371197 8:133777892-133777914 TAGGGACAAGAGTTACCTCCAGG + Intergenic
1048593744 8:135845242-135845264 AAAGCAGAAAAGAAACTTCCGGG + Intergenic
1048646489 8:136426848-136426870 AATGCAGTTGAATTACCTCCAGG + Intergenic
1050302244 9:4271475-4271497 AAAACAGAAAAGTTATCTCCAGG + Intronic
1052158026 9:25219119-25219141 AAAGTAAAAGAGGTAGCTCCTGG + Intergenic
1055731411 9:79282575-79282597 AAAGCTGCAGGGTGACCTCCAGG + Intergenic
1059171191 9:112126736-112126758 GAATCAGAAGAGTTATCTCTGGG - Intronic
1060010606 9:120040126-120040148 AATGCAGAAGAGAAACCACCAGG - Intergenic
1185919241 X:4070952-4070974 TAAGAAGCAGAGTTACCTCATGG - Intergenic
1193547388 X:82846521-82846543 AAAGCAAGATAGTTACTTCCAGG - Intergenic
1194082821 X:89489643-89489665 AAAGCAAGATAGTTACTTCCTGG + Intergenic
1194470446 X:94288094-94288116 AAAGCAGAAAAGAAACCACCAGG + Intergenic
1194624479 X:96212794-96212816 AAAGCAAATTAGTTACTTCCTGG + Intergenic
1197083292 X:122443770-122443792 AAAACAGAAGAGTTACTTAGGGG - Intergenic
1200435473 Y:3145524-3145546 AAAGCAAGATAGTTACTTCCTGG + Intergenic