ID: 1045960704

View in Genome Browser
Species Human (GRCh38)
Location 8:107964690-107964712
Sequence TCTGCTTTGCAGGGGGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045960691_1045960704 14 Left 1045960691 8:107964653-107964675 CCTGCTCTGTTCAGCCATTTCTC 0: 1
1: 0
2: 1
3: 32
4: 321
Right 1045960704 8:107964690-107964712 TCTGCTTTGCAGGGGGTGGGGGG No data
1045960694_1045960704 0 Left 1045960694 8:107964667-107964689 CCATTTCTCCAGGAGGTAACTCT 0: 1
1: 0
2: 2
3: 15
4: 177
Right 1045960704 8:107964690-107964712 TCTGCTTTGCAGGGGGTGGGGGG No data
1045960690_1045960704 15 Left 1045960690 8:107964652-107964674 CCCTGCTCTGTTCAGCCATTTCT 0: 1
1: 0
2: 0
3: 29
4: 360
Right 1045960704 8:107964690-107964712 TCTGCTTTGCAGGGGGTGGGGGG No data
1045960687_1045960704 27 Left 1045960687 8:107964640-107964662 CCAACTACAACCCCCTGCTCTGT 0: 1
1: 0
2: 3
3: 30
4: 224
Right 1045960704 8:107964690-107964712 TCTGCTTTGCAGGGGGTGGGGGG No data
1045960695_1045960704 -8 Left 1045960695 8:107964675-107964697 CCAGGAGGTAACTCTTCTGCTTT 0: 1
1: 0
2: 1
3: 15
4: 167
Right 1045960704 8:107964690-107964712 TCTGCTTTGCAGGGGGTGGGGGG No data
1045960688_1045960704 17 Left 1045960688 8:107964650-107964672 CCCCCTGCTCTGTTCAGCCATTT 0: 1
1: 0
2: 1
3: 25
4: 355
Right 1045960704 8:107964690-107964712 TCTGCTTTGCAGGGGGTGGGGGG No data
1045960689_1045960704 16 Left 1045960689 8:107964651-107964673 CCCCTGCTCTGTTCAGCCATTTC 0: 1
1: 0
2: 0
3: 22
4: 324
Right 1045960704 8:107964690-107964712 TCTGCTTTGCAGGGGGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045960704 Original CRISPR TCTGCTTTGCAGGGGGTGGG GGG Intronic
No off target data available for this crispr