ID: 1045978846

View in Genome Browser
Species Human (GRCh38)
Location 8:108160612-108160634
Sequence GTTGTGTGAAGGAGGTTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045978846_1045978851 5 Left 1045978846 8:108160612-108160634 CCACTAAACCTCCTTCACACAAC No data
Right 1045978851 8:108160640-108160662 GTCCACTACAGTCTGATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045978846 Original CRISPR GTTGTGTGAAGGAGGTTTAG TGG (reversed) Intergenic
No off target data available for this crispr