ID: 1045981904

View in Genome Browser
Species Human (GRCh38)
Location 8:108199604-108199626
Sequence AATCGAATGCTGCCACAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045981900_1045981904 19 Left 1045981900 8:108199562-108199584 CCTCTCATGCTTAGTTCACACTA No data
Right 1045981904 8:108199604-108199626 AATCGAATGCTGCCACAGACTGG No data
1045981899_1045981904 20 Left 1045981899 8:108199561-108199583 CCCTCTCATGCTTAGTTCACACT No data
Right 1045981904 8:108199604-108199626 AATCGAATGCTGCCACAGACTGG No data
1045981898_1045981904 27 Left 1045981898 8:108199554-108199576 CCTAGATCCCTCTCATGCTTAGT No data
Right 1045981904 8:108199604-108199626 AATCGAATGCTGCCACAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045981904 Original CRISPR AATCGAATGCTGCCACAGAC TGG Intergenic
No off target data available for this crispr