ID: 1045982398

View in Genome Browser
Species Human (GRCh38)
Location 8:108206101-108206123
Sequence AAGGATTGGTTTGGTTTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 213}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045982398_1045982404 30 Left 1045982398 8:108206101-108206123 CCAGCCAAACCAAACCAATCCTT 0: 1
1: 0
2: 1
3: 21
4: 213
Right 1045982404 8:108206154-108206176 CCAACCGTGTTAGATGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045982398 Original CRISPR AAGGATTGGTTTGGTTTGGC TGG (reversed) Intronic
911349234 1:96732677-96732699 AAAGATTGGTTTGGGTTGGTAGG + Intronic
912957529 1:114165894-114165916 AGGGATTGGATTGGATTGGATGG + Intergenic
917124745 1:171677117-171677139 AAGAATTGGATGGGTTTGGCCGG + Intergenic
918478775 1:184954718-184954740 AATGTTTGGTTTGGTTTGGTTGG + Intronic
918646686 1:186914421-186914443 AAGGAAGGGGTTTGTTTGGCCGG + Intronic
919532173 1:198736333-198736355 AAGGATTGGAAGGGTATGGCAGG - Intronic
920748426 1:208651080-208651102 AAGGATGGGTTTGCTTTTTCTGG - Intergenic
922358911 1:224803117-224803139 ATGGATTGGTTTGGGATGGAAGG - Intergenic
1062804346 10:405993-406015 AGGGATTGGTTTGGCTTGGTTGG - Intronic
1064689175 10:17896166-17896188 AAGGATGGGTTTGTGTTGGAAGG + Intronic
1065821637 10:29530869-29530891 AGAGTTTGCTTTGGTTTGGCTGG - Intronic
1065913747 10:30334164-30334186 AAGGAGTGGTTAATTTTGGCTGG + Intronic
1066202016 10:33150937-33150959 GAGGATGGGTTTGGTTGGGAGGG - Intergenic
1067737044 10:48864542-48864564 AAAGATTGTTTTGGTTTTGGAGG + Intronic
1068589179 10:58836412-58836434 GAGGATTGATTTTGTGTGGCAGG + Intergenic
1068983459 10:63085464-63085486 GAGGATTGCTTGGGTTTGGGAGG + Intergenic
1070329255 10:75406026-75406048 AAGGGTTGGGTGGGTTTGGAGGG + Intergenic
1071751405 10:88480716-88480738 AAGTATGAATTTGGTTTGGCCGG - Intronic
1073754438 10:106565856-106565878 AAGCATTTTTTTGGTTTGGTTGG - Intergenic
1074581918 10:114727192-114727214 AAGCATTTGTTTGTTTTGGCAGG - Intergenic
1075224509 10:120614574-120614596 AAGGAATAGTTTGGTCTTGCTGG + Intergenic
1079035515 11:17016078-17016100 AAGGACTGGTTAGGTTTGACTGG + Intergenic
1079379703 11:19927059-19927081 AAAGTTTGGTTTGGTTTTTCTGG - Intronic
1080331512 11:31145289-31145311 AAGGATTGATGGGGTTTGTCTGG + Intronic
1081168819 11:39841030-39841052 TAGGATTGACTTGGTTTTGCAGG + Intergenic
1083188248 11:61030801-61030823 TTGGTTTGGTTTGGTTTGGTTGG + Intergenic
1087104677 11:94397827-94397849 AAGGAGTGGATTGGCTTGTCTGG + Intronic
1089136156 11:116251023-116251045 TTGGGTTGGTTTGGTTTGGTAGG + Intergenic
1089929963 11:122299928-122299950 AAGGTCTACTTTGGTTTGGCTGG - Intergenic
1095174855 12:39079877-39079899 AAATATTTGTTTGGTTTGTCAGG - Intergenic
1097339171 12:58417880-58417902 AGGGATTGTGTTGGTATGGCTGG + Intergenic
1097374649 12:58826990-58827012 TAGGATTGCTTTGGTTAGTCAGG - Intergenic
1097548267 12:61032404-61032426 TGGGATTGGTTTGGTTTAGTTGG - Intergenic
1099132587 12:78854462-78854484 AAAGTTTGTTTTAGTTTGGCTGG - Intergenic
1101849481 12:108390826-108390848 AAGGATTGGATTGGTTAGGCTGG + Intergenic
1102990165 12:117309673-117309695 AAAGAGTGGCTAGGTTTGGCTGG - Intronic
1104918150 12:132277086-132277108 GCTGATTGGTTTGGTTTGACAGG - Intronic
1107312815 13:39097822-39097844 AAGTATTGATATGGTTTGGCTGG - Intergenic
1107383256 13:39879132-39879154 AGAGATTGCTTTAGTTTGGCAGG - Intergenic
1107677405 13:42811288-42811310 AGGGATTGGTGTGGGATGGCAGG + Intergenic
1107718333 13:43222320-43222342 ATGAATTGATTTGTTTTGGCTGG - Intronic
1108037149 13:46302933-46302955 AAGGATTGCTTTGGTTATTCAGG - Intergenic
1108469947 13:50757518-50757540 AAGTTTTGCATTGGTTTGGCTGG - Intronic
1109407467 13:61920077-61920099 TAGGTATGGTATGGTTTGGCTGG - Intergenic
1109836699 13:67868087-67868109 AGGGTTTTGTTTGGTTTGGTTGG - Intergenic
1110745625 13:79050029-79050051 GAGGATTGGCTGGGTTTGACAGG + Intergenic
1110963767 13:81665080-81665102 TAGGATTGGTTGAGTGTGGCTGG - Intergenic
1116001504 14:39247244-39247266 AAAGAATGGTTTGGATTGGGAGG + Exonic
1116027103 14:39527940-39527962 CAGGATTGCTTTGGTTTTTCAGG + Intergenic
1116610222 14:47059765-47059787 TTTGTTTGGTTTGGTTTGGCTGG - Intronic
1117553112 14:56856185-56856207 AAGAATTGATTGGGTTGGGCTGG - Intergenic
1118051680 14:62036305-62036327 ACGCATTGGTTGGGTATGGCTGG + Intronic
1119196104 14:72717820-72717842 AAGGATTGGCTTCCTTTGGCTGG - Intronic
1119658317 14:76433091-76433113 GAGGTTTGGTTTGGTTTTGGTGG - Intronic
1119740820 14:77012707-77012729 AAGACTTAGTTGGGTTTGGCTGG - Intergenic
1122266412 14:100548951-100548973 AAAGATTGGTTGGGTGTAGCAGG - Intronic
1122997479 14:105273199-105273221 AGGGCTTGGTTTGGGCTGGCTGG + Intronic
1202833735 14_GL000009v2_random:62621-62643 AAGGATTGGAAGGGTTTGGAGGG + Intergenic
1124078321 15:26467426-26467448 TAGGATTGCTTTGGTTATGCAGG - Intergenic
1125038706 15:35157938-35157960 AAGGATTTTTTTTTTTTGGCTGG - Intergenic
1126681377 15:51205474-51205496 ACAGATGAGTTTGGTTTGGCTGG + Intergenic
1127731583 15:61807022-61807044 GAGGACTGGTTTGGGTGGGCGGG + Intergenic
1133787242 16:8983117-8983139 CAGAAGTGGTATGGTTTGGCCGG + Intergenic
1133967400 16:10541461-10541483 AAGGCCTGTTTTTGTTTGGCCGG - Intronic
1136415747 16:30102462-30102484 GAGGAATGGTTTGATTTGGTGGG - Intergenic
1137372245 16:47918421-47918443 AAGGTATAGATTGGTTTGGCTGG + Intergenic
1137707738 16:50547615-50547637 AAGGGTTTGTTTGTTTTGTCTGG - Intergenic
1139182824 16:64767891-64767913 AATGTTTGATTTGGTTTGGATGG + Intergenic
1140319792 16:73938759-73938781 AAAGATTGTTTTGGTTGGCCGGG - Intergenic
1140747867 16:77996965-77996987 AATTGTTGGTTTGGTTTGTCTGG - Intergenic
1142434273 16:90047142-90047164 CAGGATTGGTGTGGGTAGGCGGG - Intergenic
1142759352 17:2034256-2034278 AAGGATGGGTTTGGAGTGGGAGG + Intronic
1143973073 17:10809779-10809801 TTGGTTTGGTTTGGTTTGGTTGG - Intergenic
1144410744 17:14998627-14998649 ATGCATTGATTGGGTTTGGCTGG - Intergenic
1145363835 17:22236192-22236214 AATGTTTGTTTTGATTTGGCAGG - Intergenic
1146345677 17:32059026-32059048 GAGGAATGGTTTTGTGTGGCTGG + Intergenic
1147330523 17:39696425-39696447 GAGGATGGGTTTGCTTGGGCGGG + Intronic
1150456720 17:65312236-65312258 AAGTATAGGTTTGTTGTGGCAGG - Intergenic
1151228175 17:72662005-72662027 TAGGATTGGTTTGCTTTGCTGGG - Intronic
1203170336 17_GL000205v2_random:142787-142809 TAGGATTGTTTTGGGTTGACAGG + Intergenic
1153736013 18:8068801-8068823 TAAGATTGGTTTATTTTGGCCGG + Intronic
1157244573 18:46041849-46041871 AAGAGTTGGTCTGCTTTGGCTGG - Intronic
1157441961 18:47718465-47718487 AGGAATTGGAGTGGTTTGGCAGG - Intergenic
1158297954 18:56020079-56020101 AGGGAATGGTTTTGTTTGGTTGG - Intergenic
1158523334 18:58189979-58190001 AATACTTGGTTTGGTTTGACTGG - Intronic
1159436870 18:68429456-68429478 AAGTAGTGATATGGTTTGGCTGG - Intergenic
1161580403 19:5077694-5077716 AAGTTTTGGTTTGGTTTGGGAGG - Intronic
1162261344 19:9536836-9536858 AAAGTTTGGTTTTATTTGGCTGG + Intronic
1162672491 19:12268831-12268853 AAGGATTGCTTGAGCTTGGCAGG - Intronic
1162990201 19:14297043-14297065 GAGGAATGGTTTTGTGTGGCCGG - Intergenic
1166012225 19:39951083-39951105 AAGGCAAGGATTGGTTTGGCCGG - Intergenic
1166012439 19:39952516-39952538 AAGGCAAGGATTGGTTTGGCCGG + Intergenic
925041481 2:734549-734571 AAGGAAGGGTTTTATTTGGCTGG - Intergenic
926801922 2:16666238-16666260 AGGGATTGGGATGATTTGGCTGG - Intronic
927065552 2:19467292-19467314 AAACAAAGGTTTGGTTTGGCTGG - Intergenic
928908783 2:36397219-36397241 AAGGCTTAGGTTGGTTTTGCTGG + Intronic
931046458 2:58359545-58359567 AAGGATTCCTTTGGTTTGGTGGG - Intergenic
939785746 2:146509661-146509683 AAGAATATATTTGGTTTGGCAGG - Intergenic
939844056 2:147221909-147221931 AAAGATTAGTTTGGGGTGGCAGG + Intergenic
942206324 2:173623375-173623397 AAGGAATGGTTTTGTTTGAAAGG + Intergenic
943474930 2:188342215-188342237 AGTGGTTGGGTTGGTTTGGCAGG + Intronic
943743096 2:191432351-191432373 AAAGATGGGTTTGTTTTGGCAGG - Intergenic
945645515 2:212487165-212487187 AATGCTTGGTTTGCTTTGACTGG + Intronic
945693881 2:213078808-213078830 AAGAATCACTTTGGTTTGGCAGG - Intronic
946517067 2:220424081-220424103 AAGAATTAGTTTGGATTGGATGG + Intergenic
946664022 2:222030851-222030873 AATGATACGTTTGGTTTGGTAGG - Intergenic
947448987 2:230187953-230187975 TAGGATTGCTTTGGCTTTGCAGG + Intronic
1171542140 20:25969074-25969096 AAGTATTGTTTTGGTTCAGCAGG - Intergenic
1171977154 20:31602776-31602798 ACTGATTGGTTTGGTTTTCCTGG + Intergenic
1172930278 20:38581526-38581548 AAGGATTGGTTTGGTTGTTTAGG + Intronic
1173602302 20:44304541-44304563 ATGGTTTGGTTTAGTTTGGTTGG + Exonic
1173643126 20:44617227-44617249 AAGGTGTGGTCTGGTTGGGCTGG + Intronic
1174271020 20:49368635-49368657 CAGGACTGGTTTGGGTTGCCTGG + Exonic
1175642679 20:60643920-60643942 AAGGATTGGTTGAGTATTGCTGG - Intergenic
1176326328 21:5504618-5504640 TAGGATTGTTTTGGGTTGACAGG + Intergenic
1176331388 21:5551585-5551607 TAGGATTGTTTTGGGTTGACAGG - Intergenic
1176396369 21:6269366-6269388 TAGGATTGTTTTGGGTTGACAGG + Intergenic
1176401429 21:6316333-6316355 TAGGATTGTTTTGGGTTGACAGG - Intergenic
1176435728 21:6672771-6672793 TAGGATTGTTTTGGGTTGACAGG + Intergenic
1176440788 21:6719738-6719760 TAGGATTGTTTTGGGTTGACAGG - Intergenic
1176459990 21:6999841-6999863 TAGGATTGTTTTGGGTTGACAGG + Intergenic
1176465050 21:7046807-7046829 TAGGATTGTTTTGGGTTGACAGG - Intergenic
1176483551 21:7381619-7381641 TAGGATTGTTTTGGGTTGACAGG + Intergenic
1176488611 21:7428585-7428607 TAGGATTGTTTTGGGTTGACAGG - Intergenic
1179456032 21:41500927-41500949 GAGGATGTGTTTGGTTAGGCAGG - Intronic
1179723921 21:43331326-43331348 GAGGATTGGCTTGGTGGGGCCGG - Intergenic
1182073327 22:27478312-27478334 TTGGATTGGTTTGGTTTGGATGG + Intergenic
1184621792 22:45684710-45684732 ATGGATTGGTCTGGGTTGTCAGG + Intronic
951859124 3:27231211-27231233 AAGTATTTGTTTGATTTGGAGGG - Intronic
957299737 3:78376311-78376333 AAGGATGGCTTTGGCTTTGCAGG + Intergenic
957320968 3:78629656-78629678 TTGGTTTGGTTTGGTTTGGTTGG - Intronic
958488247 3:94739821-94739843 AACGTTTGGTTTGCTTTTGCAGG + Intergenic
959137342 3:102440380-102440402 GAGAATTGATTTGGTTTGGGAGG + Intronic
959479014 3:106848478-106848500 TAGTTTTGGTTTGGTTTGGTTGG - Intergenic
960744361 3:120870275-120870297 AAGGTTTGGTTTCTTGTGGCAGG - Intergenic
962895929 3:139714807-139714829 TATAAGTGGTTTGGTTTGGCTGG + Intergenic
966327082 3:178769012-178769034 AGGGATTGGGTTGGGTTTGCTGG - Intronic
967444251 3:189547160-189547182 AAAGATTATTTTGTTTTGGCTGG + Intergenic
967972457 3:195009515-195009537 AAGGAAGGGCTTTGTTTGGCCGG + Intergenic
971473868 4:27054483-27054505 AAGGATTTGCTGGCTTTGGCTGG - Intergenic
972480353 4:39490704-39490726 AAGGGTGGGTTTGAATTGGCAGG - Intergenic
973136096 4:46708721-46708743 AGGGAGTGATATGGTTTGGCTGG + Intergenic
973211749 4:47622883-47622905 TTGGTTTGGTTTGGTTTGGATGG + Intronic
973319899 4:48799410-48799432 AAGAATTTGTTTGGTTGGGGAGG + Intergenic
973641546 4:52907617-52907639 AAGGGATTGTTTGGTTTGTCTGG + Intronic
980125128 4:128766754-128766776 AAGTATTTGATTGGTTTGGTTGG + Intergenic
982393201 4:154888368-154888390 AAGCATTTGTTAGCTTTGGCTGG - Intergenic
986344579 5:6822915-6822937 GAGGTTTGGTTTGGTTTGCTGGG - Intergenic
986785166 5:11107556-11107578 AAGAATTTGTTTAGTCTGGCAGG + Intronic
988640513 5:33036235-33036257 CAAGATTGATATGGTTTGGCTGG + Intergenic
989043878 5:37255403-37255425 AATGTTTGTTTTGGTTTGGCCGG - Intergenic
989089732 5:37717732-37717754 CAGGGATTGTTTGGTTTGGCAGG + Intronic
990508390 5:56467351-56467373 CAGGACTGGTTTGGTGAGGCAGG - Intronic
990953316 5:61319955-61319977 AAGGGCTGGTTGGGTTTGTCAGG - Intergenic
991428682 5:66519695-66519717 AAGGAAGGATTTGGTTGGGCAGG + Intergenic
991723210 5:69513349-69513371 AATGATTGATTTGGTCTGGCAGG - Intronic
993740096 5:91528246-91528268 ATGGATTGGTCTGGTGTGGTGGG + Intergenic
993839187 5:92855527-92855549 CAAGCTTGGTTTGGTTTGGTTGG + Intergenic
994376912 5:99025456-99025478 AAGAATTTGTTTGTTTTGGGGGG + Intergenic
996195547 5:120602024-120602046 TAGGATTGATTTGGTTTCCCTGG + Intronic
997311842 5:132892404-132892426 AGGCATTCGTTTGGTTTGGCAGG - Exonic
1001679765 5:173547513-173547535 GAGGAGTGGTCTGGTTTGTCTGG + Intergenic
1002629837 5:180564848-180564870 TAAGGTTGGTTTGGTTTGGGAGG + Intronic
1003026414 6:2559138-2559160 AGGGGCTGGTTTGTTTTGGCAGG - Intergenic
1003818414 6:9867599-9867621 TTGGTTTGGTTTGGTTTGGTTGG + Intronic
1005675264 6:28148125-28148147 ATGGATGGGTTTGGCATGGCTGG + Intronic
1006336530 6:33423942-33423964 GAGGATTGCTTTGGTTGGGAGGG - Intronic
1009332102 6:62436337-62436359 TAGGATTGCTTTGGCTTGCCAGG + Intergenic
1010906303 6:81494319-81494341 ATTGATTGGTTTGGTGTGGGTGG + Intronic
1011976332 6:93304438-93304460 AATTATTGATTTGGTTTGGGAGG - Intronic
1013130373 6:107226965-107226987 AAGGCTGGGTTTGGCTGGGCCGG - Intronic
1013187459 6:107772425-107772447 AAGGGTTTGTTTGGTTTGCAAGG + Intronic
1014726832 6:124981449-124981471 AAACATTGGTTTGGTTGGGGGGG + Intronic
1016123955 6:140376373-140376395 TTGGTTTGGTTTGGTTTGGGAGG - Intergenic
1017121985 6:151032557-151032579 AAGGGTTGATGTGGTTTGGATGG - Intronic
1018154555 6:160973487-160973509 GAGGATGGGGGTGGTTTGGCTGG + Intergenic
1018986833 6:168644071-168644093 AAGGAGTGGTCTGTTTCGGCTGG + Intronic
1019815197 7:3194810-3194832 AAGGCTTTGTTTGGTTTGGGTGG + Intergenic
1022401502 7:30042902-30042924 GAGGATTGATTTGGTTTTCCAGG + Intronic
1027384999 7:77651024-77651046 AAGGGTTTTTTTGGTTTGGTTGG + Intergenic
1027435610 7:78161167-78161189 AAGTATTAGTTTGGTTTATCTGG - Intronic
1028091926 7:86713571-86713593 AAGGATAGGTGAGGTTTGACGGG - Intronic
1028309417 7:89312067-89312089 AAGGAATGGTGTGGCTTGCCTGG + Intronic
1030280028 7:107764233-107764255 TTGGTTTGGTTTGGTTTGGTTGG + Intergenic
1031558596 7:123209198-123209220 TAGGATTGGTTTGGTTTTTTTGG - Intergenic
1031827004 7:126577912-126577934 AAGCATGGGTTGGGTTTGGTGGG - Intronic
1034185982 7:149177519-149177541 AAAGATTGGTATGATATGGCTGG + Intronic
1034543672 7:151776247-151776269 AAGGATTGATTAGGTTGGGGTGG - Intronic
1034842053 7:154407568-154407590 AAAGATGTGTTTGGTTTGGTTGG + Intronic
1036389090 8:8309055-8309077 AAGGACTGGCTGGGTGTGGCGGG + Intergenic
1036465492 8:8993327-8993349 AAGGAGGTGTTTTGTTTGGCTGG + Intergenic
1036965388 8:13291752-13291774 CAGGCTTGGTCTGGTTTGGTTGG - Intronic
1037774073 8:21821227-21821249 TGGGAGAGGTTTGGTTTGGCTGG + Intergenic
1037899337 8:22678406-22678428 AGGAATTGGGCTGGTTTGGCAGG - Intergenic
1041659710 8:60389858-60389880 AAAGGTTCCTTTGGTTTGGCTGG - Intergenic
1043997054 8:86830772-86830794 TTGGTTTGGTTTGGTTTGGCAGG - Intergenic
1045820661 8:106333920-106333942 CAGGATTGTTTTGGCTTTGCTGG + Intronic
1045982398 8:108206101-108206123 AAGGATTGGTTTGGTTTGGCTGG - Intronic
1045985450 8:108245030-108245052 AAGGATTGGTTAAGTGTGGAGGG - Intronic
1046792026 8:118332792-118332814 ATGGACTTGTTTGGTATGGCTGG - Intronic
1049981069 9:904205-904227 CAGATTTGATTTGGTTTGGCTGG + Intronic
1050300717 9:4255309-4255331 AAGGATATATTTAGTTTGGCAGG - Intronic
1051351725 9:16204104-16204126 AAGGATTTCCTTGGTTTGGTGGG - Intronic
1051375577 9:16399051-16399073 TAGGAAAGGTTTGGGTTGGCCGG - Intergenic
1051438749 9:17059837-17059859 ATGAGTTGGTTTGGTTTGGAAGG + Intergenic
1052335534 9:27316051-27316073 AAAGATTGGATGGATTTGGCCGG + Intergenic
1053375591 9:37603371-37603393 AACCATTGGTTTGGGTTAGCAGG + Intronic
1053478472 9:38398899-38398921 AAGGGTGGGTATGGTTTGGAAGG - Intergenic
1055284430 9:74713170-74713192 AAGGAGTGGTTTGCTTTGACTGG - Intergenic
1055717888 9:79138398-79138420 AGTGATTTGTCTGGTTTGGCTGG - Intergenic
1056191776 9:84191586-84191608 AAGGCTTGGTTTTGTGTGGCTGG + Intergenic
1056429691 9:86514894-86514916 AAGGATTGGTTAGTATTGGAGGG + Intergenic
1057708282 9:97413072-97413094 TTGGTTTGGTTTGGTTTGGATGG - Intronic
1058834337 9:108848013-108848035 ATGGAATGATATGGTTTGGCTGG - Intergenic
1059359557 9:113730734-113730756 AAGGATTGTTTGGGTCTGGGAGG + Intergenic
1060244973 9:121937704-121937726 CAGGATTTTTTTGGTTTGCCTGG - Intronic
1061492612 9:130954425-130954447 AGGGATTGGTTTGGATGGGGTGG - Intergenic
1061769332 9:132905923-132905945 AAGGCTTGCTTTGGTGTGTCAGG + Exonic
1203430713 Un_GL000195v1:88743-88765 TAGGATTGTTTTGGGTTGACAGG + Intergenic
1203435795 Un_GL000195v1:135889-135911 TAGGATTGTTTTGGGTTGACCGG - Intergenic
1186831662 X:13396458-13396480 AATGACTGATATGGTTTGGCTGG - Intergenic
1187834438 X:23416894-23416916 ATGGGTTGGTTTTGTTTTGCTGG + Intergenic
1189764921 X:44361360-44361382 AAAAATTGGTTTTATTTGGCTGG - Intergenic
1190632968 X:52406303-52406325 AAGTGTTGGTATGGTTTGGCTGG - Intergenic
1191779348 X:64849285-64849307 GAGGATTGGCTTGGTATGGTTGG - Intergenic
1194099805 X:89689731-89689753 TAGGATTGGTTTGGATTTGGGGG + Intergenic
1194844717 X:98790781-98790803 TAGGATTGCTTTGGTTTTTCAGG - Intergenic
1195649892 X:107273363-107273385 ATGGATGGGTTTGGGCTGGCAGG - Intergenic
1195675957 X:107507229-107507251 AAGGATTCGTTTGGGTTGCCTGG + Intergenic
1198027088 X:132717707-132717729 AAGGATTCTTTCTGTTTGGCAGG + Intronic
1200452809 Y:3351097-3351119 TAGGATTGGTTTGGATTTGGGGG + Intergenic
1201650046 Y:16275224-16275246 AAGGATTGGACTGATTTAGCAGG - Intergenic
1201769803 Y:17609127-17609149 AAGAATTGGTTAGAGTTGGCTGG - Intergenic
1201831751 Y:18296860-18296882 AAGAATTGGTTAGAGTTGGCTGG + Intergenic
1201858259 Y:18568898-18568920 AGGCCTTGGTTTGGTGTGGCAGG + Intronic
1201875062 Y:18751483-18751505 AGGCCTTGGTTTGGTGTGGCAGG - Intronic