ID: 1045982399

View in Genome Browser
Species Human (GRCh38)
Location 8:108206105-108206127
Sequence GTAAAAGGATTGGTTTGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 242}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045982399_1045982404 26 Left 1045982399 8:108206105-108206127 CCAAACCAAACCAATCCTTTTAC 0: 1
1: 0
2: 2
3: 33
4: 242
Right 1045982404 8:108206154-108206176 CCAACCGTGTTAGATGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045982399 Original CRISPR GTAAAAGGATTGGTTTGGTT TGG (reversed) Intronic
902969085 1:20033719-20033741 GTAAAGGGCTTGGTGGGGTTGGG + Intronic
903035066 1:20487435-20487457 GTAAAAGGATTGGCTGGCCTCGG + Intergenic
905492523 1:38355627-38355649 AGAAAAGGATTGATATGGTTTGG + Intergenic
905654593 1:39677862-39677884 GCAAAAGGATCTGATTGGTTTGG - Intergenic
906831290 1:49034515-49034537 TTAAAAGTATTGATATGGTTTGG + Intronic
907193992 1:52671541-52671563 ATAAAGGGATTGGCTTGCTTGGG + Intergenic
909704862 1:78569255-78569277 ATAAAAGGACTGGTGTGATTTGG - Intergenic
910677941 1:89833636-89833658 GCACTAGGATTGGTTTGGTGAGG + Intronic
911837147 1:102635107-102635129 ATAAAATAATTGTTTTGGTTTGG + Intergenic
911906636 1:103577402-103577424 GTAACAGGATAGGTTGGGTTTGG + Intronic
911910140 1:103623778-103623800 GTAACAGGATTGGTTGGGTTTGG + Intronic
911913240 1:103662569-103662591 GTAACAGGATAGGTTGGGTTTGG + Intronic
911915214 1:103689378-103689400 GTAACAGGATAGGTTGGGTTTGG - Intronic
911917560 1:103717903-103717925 GTAACAGGATTGGTTGGGTTTGG + Intronic
911920653 1:103756707-103756729 GTAACAGGATAGGTTGGGTTTGG + Intronic
912089890 1:106058524-106058546 GTAAAAGTAGTGGTATGGTGAGG - Intergenic
915374180 1:155377732-155377754 GTAAAAGGATTGGCTGGGCGCGG + Intronic
916386422 1:164276764-164276786 ATAAAAAGATTGGTTTTTTTAGG + Intergenic
916737872 1:167623956-167623978 GTTAAATGAGTGGTTTGGGTTGG - Intergenic
917124744 1:171677113-171677135 GTAAAAGAATTGGATGGGTTTGG + Intergenic
917965754 1:180177549-180177571 TTAAAAGGATTGCTTTGGGCTGG - Intronic
919986153 1:202676815-202676837 GTAAAAGCTTTGCTATGGTTTGG + Intronic
920967782 1:210715533-210715555 GTAATGGGATTAGTTTGGCTTGG + Intronic
921814388 1:219547501-219547523 TTAAAAGGAGTGGTGTGATTTGG - Intergenic
924753055 1:246914995-246915017 GTAAAAGGCTTGCTTGGATTGGG - Intronic
1063486327 10:6424122-6424144 ATAAAGGTGTTGGTTTGGTTTGG - Intergenic
1063595840 10:7434856-7434878 GTTATAGGACTGGTATGGTTCGG - Intergenic
1063875958 10:10478902-10478924 TTAAATTAATTGGTTTGGTTTGG + Intergenic
1064287071 10:14001011-14001033 ATAAATGGGTTGGTTGGGTTGGG - Intronic
1064569391 10:16676539-16676561 GATAAAGGATTGATATGGTTTGG - Intronic
1066202018 10:33150941-33150963 CTCAGAGGATGGGTTTGGTTGGG - Intergenic
1066766159 10:38804748-38804770 TTGAATGGATTGGTCTGGTTTGG - Intergenic
1067443158 10:46323750-46323772 GTAAAAGGTTTAGTGTAGTTTGG + Intronic
1067905029 10:50281702-50281724 GTGAAAGGTTTGGTTGGGTTAGG - Intergenic
1068009388 10:51428716-51428738 TAAAGAGGACTGGTTTGGTTTGG + Intronic
1068684225 10:59853204-59853226 TTAAAAGGTTTGGATAGGTTTGG + Intronic
1068886453 10:62102875-62102897 GTAATAGAACTGGTTTGCTTAGG + Intergenic
1069011850 10:63383159-63383181 GTAAAAGGTTAAGTTTGATTTGG + Intronic
1072275435 10:93817948-93817970 GTAAATGGATGGGTGTGGCTAGG - Intergenic
1072868617 10:99091962-99091984 CTAAAAGGATTTGTTTGGAAAGG - Intronic
1074578447 10:114693324-114693346 ATGAAAGGATTGGGTAGGTTGGG - Intergenic
1079807667 11:24954741-24954763 ATAAAATGATTGGTATGGTGTGG - Intronic
1080720536 11:34843983-34844005 GTAGAAACATTGGTTTGTTTGGG - Intergenic
1081200688 11:40211601-40211623 GTAAAATGGTAGGTTTGCTTTGG + Intronic
1084290234 11:68160408-68160430 GTAAATGGAGTGTTTTGATTAGG - Intronic
1085345929 11:75768327-75768349 GTATCAGGATTAGTTAGGTTAGG - Intronic
1085891697 11:80587005-80587027 GTAAAATGAGTCCTTTGGTTTGG - Intergenic
1086694691 11:89829390-89829412 GAAAAAGGATGAGTTTGGCTGGG + Intergenic
1086711457 11:90015109-90015131 GAAAAAGGATGAGTTTGGCTGGG - Intergenic
1087023314 11:93624673-93624695 CGATAAGCATTGGTTTGGTTCGG - Intergenic
1087307479 11:96503035-96503057 GTAAAGGGGTTGGTGGGGTTGGG - Intronic
1087804703 11:102543389-102543411 GTAAAAGGATTGCTTGGGCCTGG - Intergenic
1089136148 11:116250989-116251011 GAAAAGAGATTGGTTTGGTTTGG + Intergenic
1090855026 11:130603363-130603385 GGAAAATGATTGGTTTGATTAGG - Intergenic
1093510062 12:19916370-19916392 GAAGAAGGATGTGTTTGGTTGGG - Intergenic
1094081643 12:26543142-26543164 CTCAGAGGAATGGTTTGGTTTGG - Intronic
1094655122 12:32412317-32412339 GAAAAAGTATTGTTTTTGTTGGG + Intronic
1096658912 12:53110067-53110089 GTAAAAGGATTGTTTTAAGTTGG - Intronic
1098074538 12:66714938-66714960 ATAAATGGATTGGATTGGATTGG - Intronic
1098677561 12:73309785-73309807 TTAAAAGGATTGTTTTCTTTTGG + Intergenic
1099166656 12:79315302-79315324 GTGAAAGGATTGCTTGGGTTTGG - Intronic
1099657941 12:85519411-85519433 GAAAGAGGAGTTGTTTGGTTAGG + Intergenic
1099835064 12:87899493-87899515 GTAAAAGCACTCGTTTGTTTGGG + Intergenic
1100982741 12:100174557-100174579 GAAAAAAGCTTAGTTTGGTTTGG - Intergenic
1101637476 12:106557063-106557085 ATATAAGGAATGATTTGGTTGGG + Intronic
1101849480 12:108390822-108390844 AAACAAGGATTGGATTGGTTAGG + Intergenic
1103379475 12:120482620-120482642 GTAAAAAAATTGTTTTGGCTAGG - Intronic
1105355964 13:19659766-19659788 CTAAAAGTGATGGTTTGGTTTGG + Intronic
1106344541 13:28862620-28862642 GTAGAGGGTTTGGTTTGGTTTGG - Intronic
1109387649 13:61653528-61653550 GTAGAATGATTGGTTTTCTTTGG + Intergenic
1110703326 13:78575499-78575521 GTAATAGGCATGATTTGGTTTGG - Intergenic
1112193589 13:97202790-97202812 GAAAAGGGATTGCTTTGATTTGG - Intergenic
1112236113 13:97638681-97638703 GTAAAAACATTGCTTTGGATTGG - Intergenic
1112830732 13:103447071-103447093 CCAAAAGGTTTGGTTTGGTTTGG - Intergenic
1116402469 14:44524958-44524980 GTAAAAGGATTGAATTGGATGGG + Intergenic
1117843823 14:59889936-59889958 GTATCAGTATTGGATTGGTTAGG + Intergenic
1118619628 14:67602414-67602436 GTAAAAGGGGTGATATGGTTCGG - Intergenic
1120599966 14:86491227-86491249 GTAAGAGGATTGGCTTGGATAGG + Intergenic
1122511836 14:102275107-102275129 GTAAAAGTATAGGTCTGTTTTGG - Intronic
1122760593 14:104022430-104022452 GTAAAAGCACTGGCTTGGCTGGG + Intronic
1126559718 15:50030009-50030031 GTTAAAATGTTGGTTTGGTTTGG + Intronic
1126981388 15:54247834-54247856 TTAAAATGTTTTGTTTGGTTTGG - Intronic
1129083493 15:73063529-73063551 GGATAAGGATTTGTTTAGTTTGG + Intronic
1129102424 15:73278520-73278542 CTAAAAGCATTTGTTTGGCTTGG - Intronic
1129197603 15:73979722-73979744 GAACAGGGTTTGGTTTGGTTTGG - Exonic
1129838424 15:78728103-78728125 AGAACAGGTTTGGTTTGGTTTGG + Intergenic
1129925737 15:79362535-79362557 GTATAAGAATTGATATGGTTTGG + Intronic
1131464723 15:92645976-92645998 GGAAAGGGATAGGTTTGGTGAGG - Intronic
1133645254 16:7758209-7758231 GTAAAAGTTTTGGTTTGGGATGG + Intergenic
1136369658 16:29828370-29828392 GTAAAAGGGTTTTTTTGGTTTGG + Intronic
1139188848 16:64838329-64838351 GTAAAATAGTTGGCTTGGTTTGG - Intergenic
1139445809 16:66997867-66997889 GTAAGAGGATTGCTTGGGCTTGG + Intronic
1140142563 16:72272599-72272621 GTCAAGGTATTGGTTTGGTTTGG - Intergenic
1143746320 17:8996830-8996852 CACAAAGGTTTGGTTTGGTTAGG + Intergenic
1146072078 17:29691806-29691828 GCAAAATGTGTGGTTTGGTTGGG + Intronic
1148211023 17:45808619-45808641 GTACTAGGTTTGGTTTGGTTTGG + Intronic
1148675680 17:49443500-49443522 TTAAAAGGATAGGTTGGATTTGG - Intronic
1150349048 17:64428368-64428390 GTTAAAGGATTGTTTTGGCCGGG - Intergenic
1151832349 17:76561420-76561442 TAAACAGGCTTGGTTTGGTTTGG + Intergenic
1154410841 18:14141417-14141439 GGTAAAGGTTTGTTTTGGTTTGG + Intergenic
1155389362 18:25317234-25317256 GTAAAATGTTTGGTTTATTTTGG - Intronic
1156009493 18:32480109-32480131 GAGAAAGAATTGGTTTGATTTGG + Intergenic
1156210395 18:34934113-34934135 ATAAAAGGATTGTTTTCCTTTGG - Intergenic
1157718914 18:49908416-49908438 GTAAAAGGAGTGGCTTGGAATGG - Intronic
1158297955 18:56020083-56020105 GTGAAGGGAATGGTTTTGTTTGG - Intergenic
1158966212 18:62624426-62624448 TTAAAAGGATGAGTTTGGCTGGG - Intergenic
1159436871 18:68429460-68429482 GTAAAAGTAGTGATATGGTTTGG - Intergenic
1160047028 18:75395909-75395931 TTAAAAGGTTTGTTTTGGGTTGG - Intergenic
1162633205 19:11945112-11945134 GTAAAAGGCTTTGTTAGATTAGG + Intronic
1163452940 19:17389970-17389992 GTAACATGTTTGTTTTGGTTTGG - Intergenic
1164797448 19:31045390-31045412 GTAAAAGGATTGGGTTGTTGAGG + Intergenic
1164944867 19:32284959-32284981 TTTAAAGGTTTGGTTTGGTTTGG + Intergenic
1168015065 19:53566279-53566301 GTGCAAGGTTTGGTTTGGTTTGG + Intronic
925870599 2:8266453-8266475 ATGAAAGGAATGCTTTGGTTGGG - Intergenic
926596950 2:14801203-14801225 GGAGGATGATTGGTTTGGTTTGG + Intergenic
928393591 2:30927640-30927662 GTTAATGGGTTGGTTTGTTTTGG + Intronic
928816880 2:35307560-35307582 GTAGAAGGAATGGCCTGGTTTGG - Intergenic
928836392 2:35551795-35551817 GTAAATGGACTGATATGGTTTGG - Intergenic
929651088 2:43680041-43680063 GTAAAATGATGGGTTTGGATGGG + Intronic
930660253 2:54045873-54045895 GCAAAAGGATTGGCTAGGCTGGG + Intronic
931581979 2:63786131-63786153 GTAAAAGGATTGCTTGAGTCTGG - Intronic
932420990 2:71601225-71601247 GTAAAATGAGAGGTTTGGGTTGG + Intronic
933527878 2:83466694-83466716 TTAGAAGAAGTGGTTTGGTTTGG + Intergenic
934868681 2:97839231-97839253 GTAAAAGGATTGGTTGAGCCTGG + Intronic
936506019 2:113107745-113107767 CTTGAAAGATTGGTTTGGTTTGG - Intronic
936588121 2:113776636-113776658 GTTAAATGATTGCTTTGGCTGGG + Intergenic
937343426 2:121106457-121106479 CTAAGAGGATTGATATGGTTTGG - Intergenic
938566639 2:132524643-132524665 GTAAAGGGACTGTTTTGTTTGGG - Intronic
939414143 2:141871111-141871133 GTAGAAGGATTGTGTTTGTTAGG - Intronic
939833620 2:147101835-147101857 GGAATAGGTTTGGTATGGTTTGG - Intergenic
940317161 2:152337007-152337029 GAAAAAGGAATGGTTTGGTATGG + Intronic
940449905 2:153824382-153824404 GTAAAATGATTTATTTTGTTTGG - Intergenic
942968211 2:181922991-181923013 ATAAATAGATTGATTTGGTTTGG + Intronic
943408220 2:187515002-187515024 GTAAAAGGTTTTGTCTGGTCAGG - Intronic
944793235 2:203154948-203154970 AAAAAAGGTTTGGTTTGGCTAGG + Intronic
945206094 2:207334135-207334157 GTCAAAGGATTGATTTGCATAGG - Intergenic
945916960 2:215714374-215714396 GAAAAAGGACTTGTTTAGTTAGG - Intergenic
946112535 2:217432759-217432781 CTAAAAGGATTCTTTTTGTTTGG + Intronic
946378868 2:219331278-219331300 GAAAAGGTATTGGTTTGTTTAGG + Intronic
946461806 2:219875605-219875627 GGATATGCATTGGTTTGGTTTGG + Intergenic
946664023 2:222030855-222030877 GGAAAATGATACGTTTGGTTTGG - Intergenic
946784093 2:223224161-223224183 TTTAAAAGATTGTTTTGGTTTGG + Intergenic
947252705 2:228125779-228125801 TAAAAAGGAGTGGTTGGGTTGGG + Intronic
947350862 2:229243347-229243369 GTTTAAGGATTGATATGGTTTGG - Intronic
1170138813 20:13104589-13104611 CTAAAAGGATTGAGCTGGTTTGG - Intronic
1172411695 20:34728638-34728660 GTAAAAAGATTTGTTTCCTTAGG - Intronic
1172958158 20:38777205-38777227 GTAAAAAGATGGTCTTGGTTGGG + Intergenic
1173105316 20:40128042-40128064 GGGAATGGTTTGGTTTGGTTAGG - Intergenic
1174846557 20:53948686-53948708 GTAAGAGAATGGGTCTGGTTTGG - Intronic
1175506453 20:59488767-59488789 GTAAAAGTCTGGGTTTTGTTGGG + Intergenic
1176862219 21:14017002-14017024 GGTAAAGGTTTGTTTTGGTTTGG - Intergenic
1177903478 21:26946569-26946591 TTAAAATGAATGGTGTGGTTTGG + Intronic
1179245548 21:39631124-39631146 GTAAATGTATTAGTTTGCTTGGG + Intronic
1181460147 22:23081124-23081146 GTAAAAGCCGTGGTTAGGTTTGG + Intronic
1182410802 22:30183984-30184006 GTTAAAGAATTGGTGTGGTCAGG + Intergenic
950867444 3:16200440-16200462 GTAAGATGCTTGGTTAGGTTGGG - Intronic
952102178 3:30027250-30027272 GTAAAGGAATTGATATGGTTAGG + Intergenic
953081620 3:39625166-39625188 GGAAAAGGATTGCATTTGTTGGG - Intergenic
955779026 3:62463711-62463733 GTCAAAGGAGTGGGTTGGATAGG + Intronic
956135401 3:66093332-66093354 GTAGGAGGATTGCTTGGGTTTGG + Intergenic
957022401 3:75140236-75140258 GTAAAAGGTTTTGTTAGGTCAGG - Intergenic
957829010 3:85491352-85491374 GTTAAGGGAGTTGTTTGGTTTGG + Intronic
959346862 3:105206468-105206490 GTAAAAGGATTGCATTGGCATGG + Intergenic
961743628 3:129049034-129049056 GAAAAGTGATTGGCTTGGTTGGG - Intergenic
961968381 3:130930871-130930893 GTGTAAGGATTGGTTGGATTAGG + Intronic
962410684 3:135139340-135139362 TCAAAGGGATTGGTTTGTTTGGG + Intronic
966325024 3:178744537-178744559 AAACAGGGATTGGTTTGGTTTGG - Intronic
967459586 3:189729997-189730019 GTAAAAGGAATTGTGTGGTCAGG + Intronic
971128268 4:23778186-23778208 GTCAAAGGATACATTTGGTTGGG - Intronic
972240259 4:37183365-37183387 TGAAAAGAATTGGATTGGTTTGG + Intergenic
972933779 4:44106042-44106064 GTAAAAGGTCTGGTTTGGGGTGG - Intergenic
973319897 4:48799406-48799428 GTGGAAGAATTTGTTTGGTTGGG + Intergenic
974883682 4:67789587-67789609 TTAAAATTATTGGTATGGTTTGG - Intergenic
975398082 4:73901260-73901282 GTGAAGGGATTGGGTTAGTTTGG - Intergenic
976177047 4:82365169-82365191 GTTAAAGGATTGGCTGGGTGTGG - Intronic
976546255 4:86338813-86338835 TGAAAAAGATTGGTTTGCTTTGG - Intronic
977521126 4:98085128-98085150 TTTTAAGGTTTGGTTTGGTTTGG + Intronic
978127237 4:105148553-105148575 GAAAAGACATTGGTTTGGTTTGG + Intronic
978465178 4:109000986-109001008 GTAAATGGTTTGATTTGGTTTGG + Intronic
979727168 4:123976270-123976292 TTAAAAAGAATGGTTTGATTTGG - Intergenic
981037868 4:140191004-140191026 GTAGAAGGATTGGTTGTATTGGG + Intergenic
981324638 4:143431846-143431868 GAAAAAGGATTTGTGAGGTTGGG - Intronic
982316205 4:154034570-154034592 ACAAAAGGATGGGTTTGCTTTGG - Intergenic
983101139 4:163626933-163626955 GAACTAGGTTTGGTTTGGTTTGG - Intronic
985119398 4:186624650-186624672 GTAAAAGGTTTGGTCTGATTAGG - Intronic
988634868 5:32971552-32971574 GTAAAAGGTGTGGTTGGGGTGGG + Intergenic
988808634 5:34763848-34763870 CTAAATTGATTGTTTTGGTTTGG + Intronic
989331804 5:40268576-40268598 TTAAAAGAATTGGTTTAGCTGGG + Intergenic
989602389 5:43212165-43212187 GTAAAAGGATTGGGGTGGTGTGG + Intronic
989686098 5:44089327-44089349 GTAAAGGGATTGGTGTGTATGGG + Intergenic
991096225 5:62742706-62742728 GTAAAAGGCAAGATTTGGTTAGG - Intergenic
993798868 5:92303791-92303813 AATACAGGATTGGTTTGGTTTGG + Intergenic
994376908 5:99025452-99025474 CTAAAAGAATTTGTTTGTTTTGG + Intergenic
995288483 5:110420059-110420081 GAAATAGGGTTTGTTTGGTTTGG + Intronic
996180890 5:120419145-120419167 GTAAAAGAATTGTTTTATTTGGG + Intergenic
996567934 5:124901071-124901093 TTAAAATGAATGGCTTGGTTAGG + Intergenic
997458862 5:134038689-134038711 GTAAAAGGATTCACTTGGTGAGG - Intergenic
997804662 5:136905264-136905286 TTAAAAAGATTGGCTGGGTTTGG - Intergenic
999417506 5:151411813-151411835 GAAGGAGGTTTGGTTTGGTTTGG - Intergenic
1000804693 5:165775611-165775633 GTAAAAGGATTGATATAATTAGG + Intergenic
1002712263 5:181202467-181202489 ATAAAAGGATTGGCTGGGTGCGG - Intronic
1003303157 6:4903108-4903130 GTAAAAGGAATGGTTTGTTAGGG + Intronic
1003781734 6:9435825-9435847 GAAAAAGGCTTGGTTGGGATGGG + Intergenic
1004656446 6:17666611-17666633 GTAAGATTTTTGGTTTGGTTTGG - Intronic
1006301558 6:33196143-33196165 TTACAGGGATTGGTTTGGATGGG - Intronic
1007021234 6:38523523-38523545 CTGAGTGGATTGGTTTGGTTGGG - Intronic
1008226798 6:48929185-48929207 GTAAAAGGAGTGCTTTGGGCTGG + Intergenic
1009315531 6:62214489-62214511 GTGGGAGGATTGGTCTGGTTAGG - Intronic
1009516960 6:64632523-64632545 TAAAATGGTTTGGTTTGGTTTGG - Intronic
1010200788 6:73280456-73280478 ATAAAAGGATATGTTTGGCTTGG - Intronic
1014288578 6:119531670-119531692 GTAAAATGATTGGGTTGGATAGG + Intergenic
1014931443 6:127341453-127341475 GTTAAACGATTGGTTTTTTTTGG + Intronic
1016123959 6:140376387-140376409 GAAAATGGTTTGGTTTGGTTTGG - Intergenic
1016508892 6:144817533-144817555 GCTAAAGTAATGGTTTGGTTTGG - Intronic
1016927644 6:149367843-149367865 GGGAAAGGATTGATTTGGATGGG + Intronic
1017186038 6:151601363-151601385 GTAAAAGAAGTGATATGGTTTGG - Intronic
1018283476 6:162213128-162213150 CAAAAAGGATTGGGTTGTTTGGG + Intronic
1018357403 6:163032661-163032683 ATAAAATGATTGGTTTTCTTTGG - Intronic
1018986832 6:168644067-168644089 GTAGAAGGAGTGGTCTGTTTCGG + Intronic
1019759812 7:2802489-2802511 TTAAAAGATTTGGTTTGATTAGG - Intronic
1020131384 7:5560628-5560650 GTAAAAGGATTGCTTGAGCTGGG - Intronic
1020875944 7:13693877-13693899 GTAGAAGTTTTGGTTGGGTTGGG - Intergenic
1021541698 7:21766567-21766589 GTAAAAGGATTGCTTTGGAAAGG - Intronic
1021986538 7:26102772-26102794 ACAAGAGTATTGGTTTGGTTTGG + Intergenic
1023594991 7:41820216-41820238 ATAAAAGGACTGATTTAGTTAGG + Intergenic
1026117735 7:67510443-67510465 ATAAAAGGACTGATATGGTTTGG + Intergenic
1026190728 7:68123940-68123962 GTTAAAGAATTGATATGGTTTGG + Intergenic
1033334914 7:140444276-140444298 ATAATAGAATTGGTTTGGCTGGG + Intergenic
1035415171 7:158677425-158677447 GATAAAGGATTGGGTTGGTAAGG - Intronic
1036424686 8:8633599-8633621 GTAACAGTATTGTTTTGGGTGGG - Intergenic
1039096569 8:33893309-33893331 GCAATAGGATTTGTTTGGTATGG + Intergenic
1042761361 8:72275303-72275325 GTAAAAGCATTGATTTTGTTTGG + Intergenic
1043145205 8:76645486-76645508 GTAGTAGGGTTGGTTGGGTTTGG + Intergenic
1043955968 8:86360160-86360182 TTTAGAGGATTGGTTTGGTTTGG - Intronic
1044566918 8:93674530-93674552 TAACAAAGATTGGTTTGGTTTGG + Intergenic
1045513862 8:102839153-102839175 ATAAAAATATTGGTTTGGCTAGG - Intronic
1045982399 8:108206105-108206127 GTAAAAGGATTGGTTTGGTTTGG - Intronic
1045985452 8:108245034-108245056 GTACAAGGATTGGTTAAGTGTGG - Intronic
1048964467 8:139605271-139605293 GTCAAACTCTTGGTTTGGTTTGG + Intronic
1049856285 8:144864024-144864046 GTAAAGGGCTTGGTGGGGTTGGG + Intergenic
1051509580 9:17862491-17862513 GCTAAAGGATGAGTTTGGTTGGG + Intergenic
1052384715 9:27809182-27809204 GTAAAGGGCTTGGTGGGGTTGGG + Intergenic
1053665516 9:40314850-40314872 GGAAAAGGGTTGGTTAGGGTGGG + Intronic
1053915101 9:42939897-42939919 GGAAAAGGGTTGGTTAGGGTGGG + Intergenic
1054376669 9:64454880-64454902 GGAAAAGGGTTGGTTAGGGTGGG + Intergenic
1054519098 9:66061434-66061456 GGAAAAGGGTTGGTTAGGGTGGG - Intergenic
1054731673 9:68706908-68706930 GCGAAAGGATTGGTTTCATTAGG + Intronic
1055514891 9:77024024-77024046 GTAAACACAGTGGTTTGGTTTGG + Intergenic
1055547779 9:77398466-77398488 GTAAAAGGAAGAGATTGGTTTGG + Intronic
1055964917 9:81856685-81856707 GTAAAATGATGGGTTGGTTTGGG + Intergenic
1056081825 9:83102857-83102879 GTACAAGCCTTGGATTGGTTGGG + Intergenic
1058192367 9:101934244-101934266 GAAATAGGAGTGGTTTGGGTTGG + Intergenic
1059598705 9:115752265-115752287 GAAAGAGGATTGGACTGGTTTGG - Intergenic
1060741489 9:126100937-126100959 CTATGAGGATTGGTTTGGTTTGG - Intergenic
1061532999 9:131229463-131229485 GTAGAAGGTTTGGGTTGGCTGGG + Intronic
1185730101 X:2454815-2454837 GAAAAAGAATGGGATTGGTTGGG + Intronic
1185731593 X:2466141-2466163 GAAAAAGAATGGGATTGGTTGGG + Intronic
1185732365 X:2471848-2471870 GAAAAAGAATGGGATTGGTTGGG + Intronic
1187169486 X:16837149-16837171 GCCAAAGAATTGGTTTGGTTGGG - Intronic
1187169571 X:16838158-16838180 GCAAAAGAATTGGTTGGGTCAGG - Intronic
1187737091 X:22316122-22316144 GTAAAATTATTGATTTGTTTTGG + Intergenic
1187768673 X:22671077-22671099 GTAAAATGATTGATATGGTTTGG + Intergenic
1188167735 X:26882713-26882735 GTTAAAGGATTGTTTTAGGTTGG - Intergenic
1188927226 X:36059235-36059257 GTAAAAAGCATGGTTTGGATAGG + Intronic
1189881789 X:45501654-45501676 GTGAGAGGAATGGTTTGATTGGG + Intergenic
1190343065 X:49312677-49312699 GGAAAAAGCTTGGTTTGGTCAGG + Intronic
1191706953 X:64103852-64103874 GGAAAAAGATTGGTGTGGCTGGG + Intergenic
1192490908 X:71576918-71576940 GTAAAAGAATGGGATAGGTTTGG - Intergenic
1193365345 X:80624845-80624867 GTAAGAATTTTGGTTTGGTTTGG + Intergenic
1196461746 X:115939389-115939411 CTAAAAGGATTTCTTTGGTCAGG - Intergenic
1196853054 X:119957027-119957049 GTAAAAGAATGGTTTTGATTTGG - Intergenic
1196869523 X:120099648-120099670 GTAAAAGGTTTGGTCAGGTCAGG - Intergenic
1199093563 X:143716550-143716572 GTAACAGGCTTGGTGAGGTTTGG - Intronic
1199214769 X:145251610-145251632 GTAAAGGGCTTGGTGAGGTTGGG + Intronic
1199544841 X:148997187-148997209 GAAAAAGAATTATTTTGGTTTGG - Exonic
1200912060 Y:8539477-8539499 GTAAATGGATTGGTCAGGTAGGG - Intergenic
1201119906 Y:10864926-10864948 CTAAACGGAGTGGATTGGTTTGG - Intergenic
1202037204 Y:20647260-20647282 GTAAAAGGTTTTGTCTGGTCAGG - Intergenic