ID: 1045982400

View in Genome Browser
Species Human (GRCh38)
Location 8:108206110-108206132
Sequence ACAAAGTAAAAGGATTGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 486
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 453}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045982400_1045982404 21 Left 1045982400 8:108206110-108206132 CCAAACCAATCCTTTTACTTTGT 0: 1
1: 0
2: 3
3: 29
4: 453
Right 1045982404 8:108206154-108206176 CCAACCGTGTTAGATGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045982400 Original CRISPR ACAAAGTAAAAGGATTGGTT TGG (reversed) Intronic
900888719 1:5433561-5433583 CCAAAGTAAAAGGATAAGTGGGG + Intergenic
901201611 1:7470467-7470489 ACCAAGAAAAAGGATTAGGTGGG + Intronic
902969083 1:20033714-20033736 ACAGAGTAAAGGGCTTGGTGGGG + Intronic
903440342 1:23383294-23383316 AAAAAGTAAAAGAATTGATCAGG + Intronic
904243988 1:29172877-29172899 ACAATATAAGAGGAATGGTTGGG + Intronic
904394628 1:30210760-30210782 TAAAAGTAAAAGGATAGGCTGGG - Intergenic
904901541 1:33861681-33861703 TCAAATTAAAATGATTGGTGAGG + Intronic
905099144 1:35503263-35503285 ACAGAGAGAAAGGATTGGGTAGG - Intronic
906043057 1:42804431-42804453 CCAAATTAAAGGGATAGGTTGGG + Intergenic
906641180 1:47441403-47441425 ACAGAGTAAAAGGCTTGGACTGG + Intergenic
907546972 1:55270408-55270430 AAAAAGTAAAAGGATGGGGAAGG - Intergenic
907680887 1:56562205-56562227 AGAAATTGAAAGGTTTGGTTAGG + Intronic
908011200 1:59778999-59779021 AAAAAAAAAAAGGATTGGTTAGG + Intergenic
908454305 1:64287374-64287396 TCCAAGTAAAAGCATTGATTGGG + Intergenic
908808707 1:67957530-67957552 ACAATGAAAAAGGTTTGGCTTGG + Intergenic
909578115 1:77199163-77199185 ACAAGGTAAAAGGAGAAGTTTGG - Intronic
910800141 1:91137185-91137207 AAAAAGTAAAAACATTGGCTGGG + Intergenic
910977876 1:92926848-92926870 TCAAAGTAAAAGGATGGGAGAGG - Intronic
911910139 1:103623773-103623795 CACAAGTAACAGGATTGGTTGGG + Intronic
911917559 1:103717898-103717920 CACAAGTAACAGGATTGGTTGGG + Intronic
912235036 1:107841596-107841618 ACAAAGTAAAAGCATTAGATAGG + Intronic
912535572 1:110367196-110367218 TGAAAGTAAAAGGATTGGCCAGG + Intronic
912728308 1:112078431-112078453 CTAAAGTGAGAGGATTGGTTTGG + Intergenic
913068632 1:115280258-115280280 TCAAAGTGAAAGGAATGGTGGGG + Intergenic
913523828 1:119671277-119671299 AGAAAGTAAAAAGATAGCTTAGG - Intronic
914771732 1:150692624-150692646 CCAAGGTAAGAGGATTGCTTGGG - Intronic
915335961 1:155141562-155141584 ACAAAGTAAGAGAAAAGGTTAGG + Intergenic
915374179 1:155377727-155377749 AAATAGTAAAAGGATTGGCTGGG + Intronic
915810161 1:158900535-158900557 CCAAATTAAAAGGATAGGTTGGG + Intergenic
916178641 1:162064616-162064638 AAAAAGGGAAAGGATTGGCTGGG - Intergenic
916591852 1:166198976-166198998 ACAAACAAAAAGCATTGCTTAGG - Intergenic
916828700 1:168468915-168468937 TCAAAGTAAAATGATAGCTTGGG - Intergenic
917097882 1:171417786-171417808 ACAAGGTGAAAGGATCGCTTGGG - Intergenic
917520285 1:175742646-175742668 AGAAAGTAAAAGGTCAGGTTGGG + Intronic
917855419 1:179095387-179095409 AAAAAGAAAAAGGATTGGCTTGG - Exonic
917865205 1:179187986-179188008 AGAAAGTAAAAGAATTGTGTGGG - Intronic
918323445 1:183386603-183386625 AAAAAGCAAAATAATTGGTTTGG + Intronic
918656863 1:187037671-187037693 ACAGAATAAAAGGATTGTTGTGG - Intergenic
919542142 1:198861636-198861658 ACAAAGCAAAAAAATTGCTTTGG - Intergenic
920740666 1:208578537-208578559 ACAGAGTAAAAGGAATAGTGGGG - Intergenic
921917479 1:220628376-220628398 AGAAAGTAAATGGATTGGTGAGG - Intronic
922088210 1:222370851-222370873 ACAGAGTAAAATGATGGGATGGG - Intergenic
922844483 1:228672861-228672883 ACAAAGTCAATGAATTGGCTGGG + Intergenic
924278226 1:242409762-242409784 ACATATTAAAAGGCTAGGTTGGG - Intronic
924394344 1:243603230-243603252 AGAATGTAAAAGGGTTGGTTTGG - Intronic
924726727 1:246678294-246678316 AAAAAGAAAAAGAAATGGTTGGG - Intergenic
1063669321 10:8087320-8087342 AGAAAGTAAAGGTAGTGGTTGGG - Intergenic
1064017944 10:11787310-11787332 AAAAAATAAAAGGAATGCTTTGG + Intergenic
1064849253 10:19692377-19692399 ACTAAATAAATGGCTTGGTTTGG + Intronic
1065029999 10:21576225-21576247 AAAAAGTAAATGGATAGGCTGGG - Intronic
1065668403 10:28087308-28087330 ATAAAGAAAAATGATTTGTTTGG - Intronic
1066075808 10:31875489-31875511 AAAAAGACAAAGGATTGGGTAGG + Intronic
1066558091 10:36637999-36638021 AAAAAATACAAGGATTGGCTTGG - Intergenic
1066619311 10:37326994-37327016 CCAAAATAAAGGGATGGGTTTGG - Intronic
1067050400 10:43013541-43013563 ACAAACAAAAAAGCTTGGTTAGG + Intergenic
1067905030 10:50281707-50281729 ATGAAGTGAAAGGTTTGGTTGGG - Intergenic
1068289105 10:54978754-54978776 ACAAAGTAACAGGAATGTTGAGG - Intronic
1068337383 10:55652783-55652805 CCAAAATAAAGGGATGGGTTTGG - Intergenic
1068588095 10:58823208-58823230 ACAAACTAAAAGAATAGGTCGGG - Intronic
1068955740 10:62817708-62817730 GCAAAGTAAAACGAGTGGGTTGG - Intronic
1069061989 10:63903941-63903963 CTAAAGAAAAAGGATTGTTTGGG - Intergenic
1069090258 10:64191943-64191965 ACAAAGTGAATGCCTTGGTTAGG - Intergenic
1069334232 10:67328828-67328850 AAAAAGAAAAAGAATTGGTGGGG - Intronic
1070201772 10:74213542-74213564 AAAAAGTAAAAGGAGTGGGCTGG + Intronic
1070474476 10:76818372-76818394 ACAAAGTACATTGATTAGTTAGG - Intergenic
1070475293 10:76823447-76823469 ACAAAGTACATTGATTAGTTAGG - Intergenic
1070475909 10:76828963-76828985 AGAAAGAAAAGGGATTAGTTAGG + Intergenic
1071996934 10:91158721-91158743 ACCAAGAAAAAGCATTGTTTGGG - Intergenic
1072347641 10:94524363-94524385 AGAAAGAAAAAGAAATGGTTTGG + Intronic
1072598761 10:96902634-96902656 ACAAAGTGAAAGTATTGGGTTGG - Intronic
1072651946 10:97302749-97302771 AAAAAGGAAAAAGATTAGTTGGG + Intergenic
1073639654 10:105238550-105238572 CCAAAGTTAAAGGATTCATTTGG + Intronic
1076801259 10:132830435-132830457 ACAAAGAAAAAGCCTTGGCTGGG - Intronic
1077210059 11:1366611-1366633 CCAAATTAAAAGAATAGGTTGGG + Intergenic
1077915235 11:6607234-6607256 ACAAAACAAAACAATTGGTTTGG - Intronic
1078806287 11:14708354-14708376 ATAAAGAAAAAGGATTTATTTGG - Intronic
1079307000 11:19332205-19332227 ACAGAGTAAAAGAATTAGTTGGG - Intergenic
1079926680 11:26502150-26502172 AGAAAGTAAAAGGGTTAATTTGG + Intronic
1083012631 11:59418104-59418126 AGAAAGGAAAAGGAATGCTTGGG + Intergenic
1083221404 11:61255177-61255199 AAAAAAAAAAAAGATTGGTTGGG - Intergenic
1083834840 11:65259784-65259806 ACAAAGTTAAAAGACAGGTTGGG + Intergenic
1084107646 11:66990422-66990444 ACAGAGAGAAAGGATGGGTTGGG - Intergenic
1085002824 11:73056471-73056493 ACAATGAAAAAGGACTGTTTAGG + Intronic
1085337651 11:75708364-75708386 CCAAAATAAAGGGATGGGTTTGG + Intergenic
1085719433 11:78899892-78899914 ATAAAGAAAAAGGATTTATTTGG - Intronic
1085912998 11:80850851-80850873 ACAAAGTATATGGATGGGGTGGG - Intergenic
1087064540 11:94015147-94015169 CCAAAGTAAAGGGATGGGTCTGG - Intergenic
1087307481 11:96503040-96503062 ACAGAGTAAAGGGGTTGGTGGGG - Intronic
1087804704 11:102543394-102543416 TTGAAGTAAAAGGATTGCTTGGG - Intergenic
1092310002 12:7342354-7342376 CCAAAATAAAGGGATGGGTTTGG - Intergenic
1092815458 12:12308960-12308982 AACAAGTAAATGGATTTGTTTGG - Intergenic
1092952781 12:13523534-13523556 AAACAGTAAAAGCATTGGTGAGG - Intergenic
1092985933 12:13846514-13846536 ACACAAGAAAAAGATTGGTTTGG - Intronic
1093538487 12:20251559-20251581 ACAAAGTAAAAACATTTTTTTGG + Intergenic
1093861993 12:24177100-24177122 ACAAAATAACAGCATTGCTTGGG + Intergenic
1093925836 12:24907554-24907576 ACAAAGTCAATTGATCGGTTAGG - Intronic
1094243760 12:28261999-28262021 ACAAAGGAAAAAGATAGCTTTGG - Intronic
1094701302 12:32873258-32873280 ACAAAGTACAAGAATTAGCTGGG - Intronic
1095702528 12:45205122-45205144 ACAAAATAAAAGCATTACTTTGG + Intergenic
1095733485 12:45531692-45531714 ACAAAGAAAAAAGAGTGGTGGGG - Intergenic
1096081218 12:48833957-48833979 ACAAAGTCAAAGATTTGGTCTGG + Intronic
1097275737 12:57812327-57812349 ACAAAACAACAGGATGGGTTGGG - Intronic
1097693835 12:62758922-62758944 ACAAAGTACATTGATCGGTTAGG - Intronic
1098081637 12:66792132-66792154 ACAAAGCAAAAGAACTGATTTGG + Intronic
1098448873 12:70596496-70596518 AGAAAGTGAAAGGGTAGGTTTGG - Intronic
1098474426 12:70883749-70883771 AAAAAATGAAAGGATTAGTTAGG + Intronic
1099330856 12:81284839-81284861 ACACAGTAAAAGGAATCTTTTGG - Intronic
1100729196 12:97445225-97445247 ATAAAGTTACAGGACTGGTTGGG + Intergenic
1101256285 12:102980057-102980079 ACAAAGAAAAATGTTTGGTACGG + Intergenic
1101956460 12:109216513-109216535 AAAAAGAGAAAGGATTGGCTGGG - Intronic
1102218820 12:111180541-111180563 GAAAAGTAAAAGGAAAGGTTAGG + Intronic
1103639428 12:122337520-122337542 CCAAAATAAGAGGATTGCTTGGG - Intronic
1104011619 12:124934691-124934713 ATAAAATAAAATGGTTGGTTTGG - Intergenic
1105486968 13:20843607-20843629 ATATAGTAAAATGATAGGTTTGG - Intronic
1105960970 13:25338870-25338892 ATAAAGTAAAATGATTAGTTAGG - Intronic
1106050074 13:26181294-26181316 AGAAAGGAAAAAGAATGGTTGGG + Intronic
1106141746 13:27017746-27017768 CCAAAGTGAAAGGACTGGTTCGG - Intergenic
1106671265 13:31907806-31907828 AAAAAGTAAACTGTTTGGTTGGG - Intergenic
1107847821 13:44535460-44535482 ATAAAGTAAAAAAATTGCTTAGG + Intronic
1108702756 13:52957673-52957695 ACAAAGTACAAAGATCAGTTAGG + Intergenic
1109043567 13:57376423-57376445 AAAAAGTCCAAGGATTGTTTTGG - Intergenic
1109453059 13:62544005-62544027 ATATAGTAACAGGATTGGTAAGG + Intergenic
1110313105 13:74073708-74073730 ACAAAGTATAAGGATTGAGGGGG + Intronic
1110327121 13:74229746-74229768 ATAAGCTACAAGGATTGGTTTGG + Intergenic
1110566792 13:76965354-76965376 ACAAATTAAAAAAATTGGCTGGG - Intergenic
1111001782 13:82193740-82193762 AAAAGGTAAAGAGATTGGTTAGG + Intergenic
1112236114 13:97638686-97638708 ATAAAGTAAAAACATTGCTTTGG - Intergenic
1112896197 13:104303324-104303346 ATAAAGTATAATGACTGGTTGGG - Intergenic
1113146631 13:107215239-107215261 AAAAAGAAAAAGGATATGTTCGG - Intronic
1115772022 14:36673700-36673722 ACAAAGAAAAAAGAATGGGTAGG + Intronic
1116402467 14:44524953-44524975 CCAAAGTAAAAGGATTGAATTGG + Intergenic
1116664252 14:47754566-47754588 CCAAAGTAAAGGGATGGGTTGGG + Intergenic
1117100709 14:52343508-52343530 ACAGAGTAAAAGAAGTGGCTAGG + Intergenic
1117604969 14:57419044-57419066 ACAATGTTAAATGATTGGATTGG + Intergenic
1119819326 14:77601294-77601316 ACAAAGTACATTGATCGGTTAGG - Intronic
1120089947 14:80320092-80320114 ACATATTAAAAGCATTGGCTGGG + Intronic
1120246641 14:82014121-82014143 ACCAAGTAGTAGGATTGCTTGGG - Intergenic
1121537634 14:94701793-94701815 AAAAAAAAAAAGGATTGGTGGGG + Intergenic
1123158088 14:106249986-106250008 AGAAATTAAATGGACTGGTTGGG + Intergenic
1123900995 15:24877105-24877127 ACAAAGGAAAAGTATGGGTGGGG + Intronic
1123963274 15:25429712-25429734 AGAATGTAATAGGATTGGTGTGG + Intronic
1125203019 15:37118908-37118930 AGAAAGTAATAGGATTGGAAAGG - Intergenic
1125684552 15:41556133-41556155 AGGAAGTAAAAGGCTGGGTTGGG + Intergenic
1126908588 15:53394588-53394610 ACCAAGGAAAAGGACTGGTCAGG - Intergenic
1127278783 15:57471068-57471090 ACAAAGAAAAAATATTGATTTGG + Intronic
1127295511 15:57605296-57605318 ACAAAGTAAAAGAAGGGGTAGGG + Intronic
1128286102 15:66438380-66438402 GAAAAATAAAAAGATTGGTTGGG - Intronic
1128316135 15:66660635-66660657 CCAAAGTAAATGGAATGGCTGGG - Intronic
1128417840 15:67463410-67463432 ACATAGGATAAGGATTGGCTGGG + Intronic
1129005008 15:72365392-72365414 AAAAAGTAAAAAGAATGGCTGGG - Intronic
1129437118 15:75550490-75550512 AAAAAATAAAAAGATTGGCTGGG + Intronic
1129514150 15:76146689-76146711 ACAAAGAAAAAGGAGGGGTAGGG + Intronic
1129977648 15:79835627-79835649 ACAAATTAAAAAAATTAGTTGGG - Intronic
1131769481 15:95719428-95719450 AGAAATTAAAAGGATTGCTATGG - Intergenic
1133645252 16:7758204-7758226 TGAAAGTAAAAGTTTTGGTTTGG + Intergenic
1134768782 16:16785720-16785742 ATAAAGTAAAAAGGTTGTTTTGG - Intergenic
1135205664 16:20481875-20481897 ATAAAGTAAAGTGCTTGGTTGGG + Intronic
1135213248 16:20541938-20541960 AGAAAGTAAAGTGCTTGGTTGGG - Intronic
1136922240 16:34343054-34343076 CCAAAGTAAAGGGATGGGTCTGG - Intergenic
1136933015 16:34435751-34435773 CAAAAGGAAAAGGATTGGTCAGG + Intergenic
1136971557 16:34976063-34976085 CAAAAGGAAAAGGATTGGTCAGG - Intergenic
1136982333 16:35068752-35068774 CCAAAGTAAAGGGATGGGTCTGG + Intergenic
1136983638 16:35081280-35081302 CCCAAGTAAAGGGATGGGTTGGG + Intergenic
1138905897 16:61332775-61332797 ACAAAGTGAAAGGATTCTATTGG + Intergenic
1139086560 16:63593805-63593827 AAAGAGAAAAAGGATTGGTGAGG - Intergenic
1139199384 16:64957183-64957205 ACAGAGGAAAAGGATTGGTAAGG - Intronic
1139262246 16:65605734-65605756 ACAAAATAATATGATTAGTTTGG - Intergenic
1139536459 16:67577992-67578014 ACAAAGTTAAGGGATTCTTTAGG - Intronic
1141261785 16:82461075-82461097 ACAAAGGAAAATGACTGGCTTGG + Intergenic
1141332193 16:83121055-83121077 ACAAAGAAACAGCATTGGCTGGG - Intronic
1141913321 16:87075836-87075858 AGGAAGGAAAAGGATTTGTTAGG - Intergenic
1142602966 17:1065731-1065753 AAAAAAAAAAAGCATTGGTTTGG - Intronic
1142819442 17:2453572-2453594 ACAAAGTAAAGAGTTTGCTTTGG - Intronic
1145257037 17:21331288-21331310 ATAAAATAACATGATTGGTTCGG - Intergenic
1146050178 17:29544012-29544034 ACAAAGTAAAAGTACTGTTTGGG - Exonic
1146150303 17:30462887-30462909 CCAAAATAAAGGGATGGGTTGGG + Intronic
1146467623 17:33098734-33098756 AAAAAGAAAAAAGATTGCTTTGG - Intronic
1146876527 17:36417084-36417106 CCAAAGTAAATGGATAGGCTGGG - Intronic
1147062857 17:37895777-37895799 CCAAAGTAAATGGATAGGCTGGG + Intergenic
1147220240 17:38924504-38924526 AAAAAGTAAAAGGCTGGGTGTGG - Intergenic
1147248960 17:39141188-39141210 AAAAAGTAAAAAGATTAGCTGGG - Intronic
1147275574 17:39313553-39313575 CCAAAATAAAAGAATTGGTGGGG + Intronic
1147276322 17:39319905-39319927 ACTTAGTAAAAGGATTGGCTAGG - Intronic
1147779330 17:42928873-42928895 GCAAAGTAAAAGGGGTGCTTTGG - Intergenic
1149111736 17:53040884-53040906 ACAATGTACAATGTTTGGTTAGG - Intergenic
1149766153 17:59280420-59280442 ACAACATTAAAGGACTGGTTAGG + Intergenic
1150776089 17:68082819-68082841 ATAAAATAAAAGGCTTGATTGGG - Intergenic
1150876624 17:68977655-68977677 ACAAGGTAAAAGGATTGCCATGG + Intronic
1150938300 17:69661451-69661473 ATAAAGGAAAGGGATTGGGTGGG - Intergenic
1151280924 17:73073460-73073482 ACAGTGTAACAGGGTTGGTTTGG - Intronic
1151893981 17:76967973-76967995 AAAAAGTAAAAAAATTAGTTGGG - Intergenic
1154155688 18:11942411-11942433 AGAAAGTAAAGGAATTGGCTGGG - Intergenic
1155468711 18:26168467-26168489 ACAAGGGGAAAGGGTTGGTTAGG - Intronic
1156332833 18:36140642-36140664 ACAAAATAAAAGGCTGGGTGTGG - Intronic
1156338837 18:36192638-36192660 ATAAAATAAAACGATTGCTTTGG - Intronic
1156557499 18:38084060-38084082 AGAAAGTAAATGAATTGGTGTGG + Intergenic
1157859430 18:51127128-51127150 ACAAAATAAGAGGAATTGTTTGG - Intergenic
1158106633 18:53892060-53892082 ACAAAGCAAAAGGGTTGCTGTGG + Intergenic
1158129904 18:54140853-54140875 ACAAAGCAATAGGATTGGTTAGG + Intergenic
1158302070 18:56063548-56063570 AGAAAATTAAAGCATTGGTTTGG - Intergenic
1162213270 19:9110498-9110520 AAAAAATAAAAGGATTGGCCGGG + Intergenic
1163042502 19:14612913-14612935 AAAAAATAAATTGATTGGTTTGG - Intergenic
1163252999 19:16137740-16137762 AAAAAGTAAAACAATTAGTTGGG - Intronic
1163794664 19:19330434-19330456 AAAAAGTAAAACAATTAGTTGGG + Intronic
1164031635 19:21412251-21412273 CCAAAATAAAGGGATGGGTTGGG + Intronic
1164032329 19:21418767-21418789 CCAAAATAAAGGGATGGGTTGGG + Intronic
1164262127 19:23577043-23577065 CCAAAATAAAGGGATGGGTTTGG + Intronic
1165525147 19:36348262-36348284 ACATTTTAAAAGGATTGGGTAGG + Intronic
1165639562 19:37372631-37372653 AAAAAGTACAAGAATTAGTTGGG - Intronic
1165807853 19:38592620-38592642 AAAAAATAAAAGGATTGGCCAGG + Intronic
1166330570 19:42075975-42075997 ACGACGCTAAAGGATTGGTTGGG + Intronic
1168565121 19:57416117-57416139 AGAAAGAAACAGGATTGGGTTGG + Intronic
1202681624 1_KI270712v1_random:10407-10429 ACAAAGAAAAATGTTTGTTTGGG + Intergenic
925407316 2:3614313-3614335 CCAATGTTAAAAGATTGGTTGGG - Intronic
926329328 2:11811689-11811711 AGAAATTAAAAAGATTGGCTGGG + Intronic
927287012 2:21367472-21367494 ACAAACTAATAGGATTTGTCTGG - Intergenic
927319356 2:21724398-21724420 AAAAAGTAAAAGGATTCTTCTGG + Intergenic
927486035 2:23489037-23489059 AGAAAATAAAAGTATTGTTTAGG + Intronic
928671753 2:33610110-33610132 CCAAAATAAAGGGATGGGTTTGG - Intergenic
928702581 2:33914270-33914292 CCAAAATGAAAGGATGGGTTTGG + Intergenic
929930326 2:46250679-46250701 ACCAAGTAGAAGTATTAGTTAGG - Intergenic
930054448 2:47241112-47241134 ACAAACAAAAAGGATTTATTTGG - Intergenic
930660251 2:54045868-54045890 AACAAGCAAAAGGATTGGCTAGG + Intronic
930706166 2:54507122-54507144 ACAAAGTACATTGATCGGTTAGG + Intronic
931134451 2:59381198-59381220 AGAAAGTAAAAAACTTGGTTGGG + Intergenic
931536772 2:63286356-63286378 ACAAAGTACATTGATCGGTTAGG - Intronic
931962014 2:67492787-67492809 ACTAAGTAAAAGAGCTGGTTGGG - Intergenic
932645782 2:73500010-73500032 ACCAAGTAAAAAGGTTTGTTTGG - Intronic
934143288 2:89069121-89069143 AAAAAAGAAAAGGAATGGTTAGG + Intergenic
934225954 2:90131434-90131456 AAAAAAGAAAAGGAATGGTTAGG - Intergenic
934770691 2:96906177-96906199 AAAAAGAAAAAGTATTGGCTGGG - Intronic
935086492 2:99850857-99850879 ACAAATTAAATGGATTAATTGGG + Intronic
937684813 2:124683854-124683876 ATAAAGTAAAATGATTAGTCAGG - Intronic
937720174 2:125085805-125085827 AGAAAGAAAAAGTATTGCTTTGG + Intergenic
937790560 2:125956638-125956660 ACAAAATAAATGGAGTAGTTTGG - Intergenic
939054953 2:137353444-137353466 AAAAAGAAACAGGATTGGTTAGG - Intronic
939280619 2:140059352-140059374 AAAAAATAAAAGGATAGGATAGG - Intergenic
940086910 2:149870429-149870451 AGAAAGTAAATGGATCTGTTTGG + Intergenic
940779821 2:157920783-157920805 ACAAAAAAAAAAGATTGCTTTGG + Intronic
941258090 2:163259059-163259081 CCAAAATAAAGGGATGGGTTGGG + Intergenic
941586958 2:167371651-167371673 ACAAAATATAAGGATTAGATTGG - Intergenic
942099111 2:172560324-172560346 AAAAAATAAAAGAATTGGTCAGG - Intronic
942165572 2:173237326-173237348 ACAAAGGAAAAGAATGGGTGGGG - Intronic
942837757 2:180320626-180320648 TCAAAATAAAGGGATGGGTTGGG - Intergenic
943062161 2:183050505-183050527 TCAAAATAAAAGGATGAGTTTGG + Intergenic
943673418 2:190690450-190690472 CCAAAGCAAAAGGACTGGTACGG + Exonic
944257886 2:197642816-197642838 ACAAAATAAAAAAATTGGCTGGG + Intronic
944793234 2:203154943-203154965 AAAAAAAAAAAGGTTTGGTTTGG + Intronic
945561989 2:211350848-211350870 ACAAAGAAAAGAGATTGATTTGG + Intergenic
946206476 2:218112509-218112531 CCAAAATAAAGGGATGGGTTTGG - Intergenic
946414158 2:219531113-219531135 CCAAAGCAGAAGGATTGCTTGGG + Intronic
948998613 2:241598224-241598246 ACAAAGTAAAAGCACAGCTTAGG + Intronic
1169126200 20:3128700-3128722 AAAAAATAAAAAGATTAGTTAGG + Intronic
1170820358 20:19752303-19752325 ACAAAGTACATTGATTAGTTAGG + Intergenic
1170821031 20:19756603-19756625 ACAAAGTACATTGATTAGTTAGG + Intergenic
1172259860 20:33554001-33554023 TTAAAATAAAAAGATTGGTTTGG + Intronic
1173792682 20:45838228-45838250 AAAAAGAAAAAGAATTAGTTGGG - Intronic
1174221926 20:48962841-48962863 ACACAGTCAAAGGATTATTTTGG + Intronic
1174311238 20:49656313-49656335 ACAAAGAAAAAGGATTTATTTGG - Intronic
1174594134 20:51669952-51669974 AAAAAGTCAAAGAATTGTTTTGG + Intronic
1174918330 20:54676453-54676475 ACAAAACACAAGGAATGGTTGGG - Intergenic
1178144487 21:29722599-29722621 AGAAAATAAAAGTATTAGTTTGG - Intronic
1179579817 21:42334977-42334999 ATAAAGTAAAAGTTTTGGCTGGG + Intergenic
1181134088 22:20752046-20752068 AGAAACTAAGAGGATTGCTTTGG - Intronic
1181137695 22:20780470-20780492 ATGAAGTAAAAGGATGGGCTGGG + Intronic
1182038857 22:27220434-27220456 ACATCGTAAAGGTATTGGTTGGG + Intergenic
1184440142 22:44506235-44506257 ATAAAGTAAAAAGGTTTGTTTGG - Intergenic
1203323623 22_KI270737v1_random:94167-94189 ACAAAGAAAAATGTTTGTTTTGG - Intergenic
949576916 3:5347215-5347237 TAAAAATCAAAGGATTGGTTAGG + Intergenic
949747010 3:7306987-7307009 ACAAAGTGAAAGGATTCTCTTGG - Intronic
950152237 3:10696742-10696764 AAAAAGTAAAGGGATTGGGATGG - Intronic
950300019 3:11868698-11868720 AAAAAATAAAAGAATTGGCTGGG - Intergenic
950508929 3:13414164-13414186 ACAAAGAACAAGGATGGGTGAGG + Intronic
950736300 3:15011238-15011260 CCAAAGCAGAAGGATTGCTTGGG + Intronic
951257734 3:20469724-20469746 ACAAGGCAGAAGGATTGCTTGGG - Intergenic
951788024 3:26444912-26444934 CCAAAGGAAAAAGAGTGGTTGGG + Intergenic
951821903 3:26823258-26823280 CCAAAATAAAGGGATGGGTTGGG + Intergenic
952101841 3:30022855-30022877 ACAAAGTAAAGGGAGGAGTTGGG + Intergenic
952173135 3:30831563-30831585 ACAAAGGGAAAGTCTTGGTTTGG - Intronic
952650064 3:35715279-35715301 AAAAAGGAAAAAGGTTGGTTAGG - Intronic
953242302 3:41160417-41160439 ACAAAATAAAACAATAGGTTGGG + Intergenic
953655436 3:44848479-44848501 AGAAAATAAAAAGATTGCTTAGG - Intronic
954281680 3:49584178-49584200 ATAAATTAAAAGGATTGGCCGGG - Intronic
954505216 3:51064232-51064254 ACAAAGTAACATAATTGATTTGG - Intronic
954507027 3:51086179-51086201 CCAAAATAAAGGGATGGGTTTGG + Intronic
954843231 3:53531534-53531556 ACAAAGTTAAATGATTTGGTGGG + Intronic
955509914 3:59669287-59669309 ACAATCAAAAAGGATGGGTTTGG - Intergenic
955908020 3:63828254-63828276 GATAAGTAAAAGCATTGGTTTGG - Intronic
956540339 3:70330805-70330827 ACAAATTTAAATGATTTGTTCGG - Intergenic
956566818 3:70648344-70648366 CCAAAGGAAAAGGATTAGTAAGG + Intergenic
956870173 3:73409029-73409051 ACCAAGTAAATGGAATGTTTTGG + Intronic
957022402 3:75140241-75140263 ACAGTGTAAAAGGTTTTGTTAGG - Intergenic
958036086 3:88172057-88172079 ATAAAGAAAAAGGATTTATTTGG + Intergenic
959096256 3:101959261-101959283 ATAAAGTAATAAGATTGTTTTGG - Intergenic
959346861 3:105206463-105206485 ATAATGTAAAAGGATTGCATTGG + Intergenic
960449481 3:117788873-117788895 ACACAGATAAAGGATTGGTTTGG - Intergenic
961253465 3:125525682-125525704 ACAAAGTAAATTGATCAGTTAGG + Intergenic
961859835 3:129907052-129907074 CCAAAACAAAAGGATGGGTTGGG - Intergenic
964177656 3:153844318-153844340 ACAAAGTGAAAGAAGTGTTTGGG + Intergenic
964555512 3:157933123-157933145 ACAAAGACAAAGCATTTGTTGGG + Intergenic
965023739 3:163270020-163270042 AAAAAGAAAAAGGAGTTGTTTGG + Intergenic
966667312 3:182486563-182486585 ACAAAGTATAAGGTATGGCTAGG + Intergenic
967031797 3:185614672-185614694 ACAAAGGAAAAGAATTGCTCAGG + Exonic
969841106 4:9882718-9882740 AAAAAAAAAAAGGATTAGTTTGG + Intronic
970497897 4:16645554-16645576 AAAAAAAAAAAGGATTGGTTAGG + Intronic
972785794 4:42325812-42325834 AAAAAAAAAAAGGAATGGTTTGG + Intergenic
973574308 4:52270856-52270878 AGAGAGTAAAAAGATAGGTTAGG - Intergenic
973710515 4:53625561-53625583 CCAAAGCAGAAGGATTGCTTGGG + Intronic
974336204 4:60548539-60548561 AGTAAGTAAATGGATTGGTATGG + Intergenic
974749481 4:66117816-66117838 ACCCAGTAACAGGATTGGCTGGG + Intergenic
974866653 4:67589321-67589343 AGGAAGGAAAAGGGTTGGTTGGG + Intronic
975984186 4:80187997-80188019 ACAAGGTAAAAGGATTGAAAAGG - Intronic
976177048 4:82365174-82365196 TAAAAGTTAAAGGATTGGCTGGG - Intronic
977021547 4:91766572-91766594 ACAAAACAAAATAATTGGTTGGG + Intergenic
977581506 4:98729857-98729879 AAAAAGTAAAACAATTAGTTGGG - Intergenic
977982962 4:103347626-103347648 ACCAATAAAAAGTATTGGTTGGG + Intergenic
978164173 4:105586912-105586934 ACATAGTGAAATGATTGGGTGGG - Intronic
979126368 4:116977973-116977995 AGAGAGTAAAAGGCTTAGTTGGG - Intergenic
979660760 4:123252135-123252157 ACAAAATAAAAGGTTTGTATAGG - Intronic
981404313 4:144350017-144350039 ATAGAGAAAAAGGTTTGGTTGGG + Intergenic
981421988 4:144561569-144561591 ACAAAGTACAAGGCTGGGTGTGG - Intergenic
981609590 4:146579161-146579183 AGAAAGAAAAAAGATTTGTTTGG + Intergenic
981983146 4:150821731-150821753 ATAAAGTTCAAGGACTGGTTTGG - Intronic
982339955 4:154286020-154286042 ACAGAGCAAAAGAATTTGTTTGG + Intronic
982676030 4:158376757-158376779 CCAAATAAAAAGGATTAGTTTGG - Intronic
983340819 4:166458597-166458619 ACAAAATAAAAGAAATTGTTAGG + Intergenic
985625787 5:986147-986169 ACGAATTAAAAGAATAGGTTGGG + Intergenic
988113188 5:26850219-26850241 ACAAAGTAGAAGGATGTGTGAGG + Intergenic
988149474 5:27358198-27358220 AAAAAAAAAAAGGAATGGTTTGG + Intergenic
988205876 5:28133638-28133660 ACAAAGGAAAAGGAATCTTTAGG + Intergenic
988343875 5:30012391-30012413 CCAAATTAAAGGGATAGGTTGGG + Intergenic
989154654 5:38332700-38332722 CCAAAATAAAGGGATGGGTTGGG + Intronic
989758587 5:44986173-44986195 CCAAAATAAAGGGATGGGTTGGG - Intergenic
990488602 5:56282750-56282772 ACAAAGCAGAGGGATTGGTGAGG + Intergenic
991665165 5:68992479-68992501 ACAAAGTAAAATGTCTGGATGGG + Intergenic
992834493 5:80626833-80626855 ACAAGGGGAAAGGGTTGGTTAGG - Exonic
993320382 5:86462659-86462681 ACAATGTAAATGGCTTTGTTAGG - Intergenic
993396781 5:87399099-87399121 AAAAGGTAAAAGGATTCCTTAGG + Intronic
993718364 5:91297524-91297546 AGAAAGTAAAAGGCTGGGTGGGG + Intergenic
994771828 5:103991096-103991118 GCAAAGTAAAAGGAGTCGCTGGG - Intergenic
994895192 5:105694187-105694209 ACAGAGAAAAAGGATTGGTTTGG + Intergenic
995195136 5:109358303-109358325 CCAAAATAAAGGGATAGGTTGGG - Intronic
995700866 5:114933613-114933635 ACATAGCAAAAAGATTGCTTTGG - Intergenic
996647694 5:125836273-125836295 ACATAGTAATAGGATTTGTTTGG - Intergenic
997039266 5:130232750-130232772 AAAAAGAAAAAGCACTGGTTTGG + Intergenic
997731346 5:136180718-136180740 AAAAAATAATAGAATTGGTTGGG + Exonic
999398491 5:151246468-151246490 TCAAAGTACAAGGATTAGATTGG - Intronic
999870316 5:155742980-155743002 ACATAGTGTAAGGTTTGGTTGGG + Intergenic
1000879907 5:166685269-166685291 ACAAAATAAAATGATTGGCATGG + Intergenic
1001030660 5:168260186-168260208 ACAAAATAAAATGGGTGGTTGGG - Intronic
1002712264 5:181202472-181202494 AAAGAATAAAAGGATTGGCTGGG - Intronic
1002986945 6:2199447-2199469 AGAAAGTAAATGGATTGTGTAGG - Intronic
1003083493 6:3041793-3041815 ACAGAGTAACAGGATTAGGTAGG + Intergenic
1003160822 6:3632977-3632999 ACAAAGAAGAGGGATTGGTTTGG + Intergenic
1003781732 6:9435820-9435842 GAAAAGAAAAAGGCTTGGTTGGG + Intergenic
1004036701 6:11931456-11931478 ACAAAGTAGAAGGACTTGGTGGG + Intergenic
1004800440 6:19141019-19141041 AGAAATTAAAAGCATTGGCTGGG - Intergenic
1004942089 6:20569459-20569481 CCAAAGTAAAAGCATTCCTTTGG - Intronic
1005121201 6:22390780-22390802 AAAAAGCAAAAGGAATTGTTTGG - Intergenic
1006050475 6:31338992-31339014 CCAAAATAAAGGGATGGGTTTGG + Intronic
1007153598 6:39719820-39719842 AAAAAGCAAAAAGATTAGTTGGG + Intronic
1008150614 6:47946995-47947017 ACAAAATAAAAAAATTAGTTGGG - Intronic
1008587664 6:52963878-52963900 CCAAAATAAAGGGATGGGTTGGG - Intergenic
1008857361 6:56106265-56106287 ATAAAATAAAAGGAATGGATGGG - Intronic
1008939105 6:57026454-57026476 TCAATGTACAATGATTGGTTAGG - Exonic
1008952890 6:57179967-57179989 AAAAAGTAATAGGATTGGGAAGG + Intronic
1009661517 6:66618063-66618085 ACACAGAAAAAGGTTTTGTTGGG - Intergenic
1010381800 6:75233725-75233747 ACCAACTAAAAGGCTTGATTTGG + Intergenic
1010978754 6:82346179-82346201 ATAAAGTAAAAGAATTGGCTGGG - Intergenic
1011634559 6:89359236-89359258 ACAAATTATAAGAATTGTTTAGG + Intergenic
1012094448 6:94941253-94941275 AGTAAGTAAAAAGATTGGATTGG + Intergenic
1012542987 6:100383157-100383179 AAAAAGTAAAACGTTTGTTTTGG + Intergenic
1012915992 6:105171508-105171530 AAAAATTAAAAGAATTTGTTGGG + Intronic
1012957837 6:105590101-105590123 ACAAAGTGAAAAGATGTGTTAGG - Intergenic
1013709680 6:112882131-112882153 TCAAAATAAAAGGAAAGGTTGGG - Intergenic
1014288577 6:119531665-119531687 ATACAGTAAAATGATTGGGTTGG + Intergenic
1015259813 6:131224053-131224075 ACAATGTGAAATGATTGGCTTGG - Intronic
1015904757 6:138106048-138106070 ACAAATAAACAGGATTGGGTTGG + Intronic
1016138294 6:140574513-140574535 AGAAAGTACAAGGAATGGTCAGG - Intergenic
1016346697 6:143121016-143121038 CCGAAATAAAAGGATGGGTTGGG - Intronic
1016955004 6:149618180-149618202 AGAAAGAAAAAAAATTGGTTGGG + Intronic
1017097891 6:150821136-150821158 ATAAAGAAAAAGGTTTGATTTGG + Intronic
1017835809 6:158176859-158176881 CCAAAATAAAGGGATGGGTTGGG + Intronic
1019362889 7:614603-614625 AAAAAGTAAAAAAATTGGCTGGG + Intronic
1019740904 7:2672722-2672744 CCAAGGTGAAAGGATTGCTTAGG - Intergenic
1020064693 7:5178363-5178385 GCAAAGAAATAGGATTGGCTGGG + Intergenic
1020702886 7:11505620-11505642 ACATAATAAAAGGCTTGGATGGG + Intronic
1021541699 7:21766572-21766594 AAAATGTAAAAGGATTGCTTTGG - Intronic
1022593734 7:31691365-31691387 TCAAAAGAAAAGAATTGGTTGGG + Intronic
1022593813 7:31692281-31692303 ATAAAGAAACAGGATTGGATTGG + Intronic
1022974667 7:35546179-35546201 CCTAAATAAATGGATTGGTTTGG + Intergenic
1024125278 7:46288593-46288615 ACAAAGTAAAAATATTAGCTAGG + Intergenic
1026295890 7:69052185-69052207 ATAAAGTGACAGGATTTGTTAGG + Intergenic
1027503356 7:78983505-78983527 ACAGTGTCAAAGGATAGGTTGGG + Intronic
1028078372 7:86543571-86543593 ACAAAGTTAAAATCTTGGTTAGG - Intergenic
1028318543 7:89434261-89434283 ACAGAGTAAAGGGCTTGGTGGGG - Intergenic
1028320686 7:89456117-89456139 AAAGAGTAAAATAATTGGTTGGG + Intergenic
1028445207 7:90914288-90914310 AAAAAGTAGAAGAATTGATTTGG - Intronic
1028765041 7:94545599-94545621 ACAAAGTAATAGAATTGATAAGG - Exonic
1030655516 7:112163199-112163221 ACAAATAAAAAGAATGGGTTTGG + Intronic
1030783284 7:113627731-113627753 CCAAAATAAAGGGATGGGTTTGG + Intergenic
1031242231 7:119260546-119260568 AGAAAGTAAATGGCTTGCTTTGG + Intergenic
1031829795 7:126612886-126612908 ACAAAGTGAGAGGATTTATTTGG - Intronic
1032476593 7:132215359-132215381 ATAAAATGAAGGGATTGGTTTGG + Intronic
1033398125 7:140994863-140994885 AAAAAGTAAAAGAATTAGCTGGG + Intergenic
1033457783 7:141518094-141518116 ACAAAATAAAAGTATCGGCTGGG + Intergenic
1034825786 7:154261187-154261209 AAAAACTAAAAGAATTGGCTGGG - Intronic
1035561503 8:607658-607680 AAAAAGTAAAAAGATTAGCTGGG + Intergenic
1036893322 8:12610343-12610365 ACAAACAAAAAAGGTTGGTTGGG - Intergenic
1037005619 8:13776011-13776033 CCAAATTAAAGGGATAGGTTGGG + Intergenic
1037244462 8:16817039-16817061 CCAGAGTAAATGGAATGGTTGGG + Intergenic
1037448511 8:18992276-18992298 ACAAATTAAAAGGATTCCCTGGG - Intronic
1038719607 8:30022249-30022271 TCAAAGCAGAAGGATTGCTTGGG + Intergenic
1039759667 8:40560969-40560991 ACTAAGTAAAAGGGTTTTTTGGG - Intronic
1040782430 8:51125683-51125705 CCAAAATAAAGGGATGGGTTGGG + Intergenic
1041065275 8:54076754-54076776 CCAAATTAAAGGAATTGGTTGGG - Intronic
1041448669 8:57983526-57983548 ACCAAATAAAATGATTGGTAAGG - Intergenic
1042449973 8:68932826-68932848 ACAAAGTAAATCAATTGGTTTGG - Intergenic
1042599296 8:70482247-70482269 AAAAAGTAAAAAGATTAGCTGGG - Intergenic
1043086648 8:75843100-75843122 ACAAAGAACCAGGATTGGATGGG - Intergenic
1043197732 8:77320202-77320224 ACTAAGGAAAAGTATTTGTTGGG - Intergenic
1043572914 8:81625653-81625675 TCATAGTAAAAGGAATGGTTGGG - Intergenic
1044099395 8:88113968-88113990 ACAAAGTAAAAAGTTTAGTGGGG + Intronic
1045121049 8:99035033-99035055 AAAAATTAAAAAAATTGGTTGGG + Intronic
1045234797 8:100341886-100341908 TAAGAGTAAAAGGATTGGTGCGG + Intronic
1045982400 8:108206110-108206132 ACAAAGTAAAAGGATTGGTTTGG - Intronic
1046559618 8:115819165-115819187 ACAAAGTACATTGATTAGTTAGG - Intergenic
1046564443 8:115881164-115881186 ACAAAGGAAAAGGATGGGAAAGG + Intergenic
1047475417 8:125223624-125223646 ACAAAAGACAAGTATTGGTTTGG - Intronic
1048101542 8:131357696-131357718 CCAAAATAAAGGGATGGGTTCGG - Intergenic
1048349870 8:133607650-133607672 ACAAAGTACATTGATTAGTTAGG - Intergenic
1048680617 8:136837419-136837441 AGAAAGTAAAAGGAATGGAAAGG - Intergenic
1050184384 9:2957335-2957357 AGAGAATAAAAGGATTGGTTAGG - Intergenic
1052384713 9:27809177-27809199 ACAGAGTAAAGGGCTTGGTGGGG + Intergenic
1052948139 9:34184915-34184937 AAAAAAAAAAAGGATTGGCTGGG - Intronic
1054977130 9:71160910-71160932 ACAAAATATAAGGCTTGCTTAGG - Intronic
1055798069 9:79997752-79997774 ACAAAGAAAAAAGATTTATTTGG - Intergenic
1055988590 9:82080265-82080287 ACAAAGTTAAAGTAATGGTATGG - Intergenic
1056634334 9:88319336-88319358 AGAAAATAAAAGGATTGGCCAGG + Intergenic
1057014802 9:91642286-91642308 TCAAAGTTAAAGTAGTGGTTGGG + Intronic
1057378429 9:94545236-94545258 ACAAAGTACATTGATTAGTTAGG - Intergenic
1058293803 9:103279357-103279379 AGAAAAGAAAAGGATAGGTTAGG - Intergenic
1058343908 9:103935173-103935195 ATAAAGTAAAAGCATTTGTGGGG - Intergenic
1059063388 9:111057242-111057264 ACAAAGTGAAAGAAGTGGCTGGG - Intergenic
1060697860 9:125724581-125724603 ACCAAGGAAAAGGTGTGGTTTGG + Intergenic
1060777343 9:126384997-126385019 ACAAATTAAAAAAATTGGCTGGG - Intronic
1061308386 9:129746038-129746060 AAAAAAAAAAAAGATTGGTTGGG + Intronic
1061984380 9:134121413-134121435 ATAAAGAAAAAAGATTGATTTGG + Intergenic
1186023459 X:5283031-5283053 CCAAAATAAAAGGGTTGGTGGGG + Intergenic
1186939700 X:14492044-14492066 AGAAAGTAACAGGATCTGTTTGG - Intergenic
1187540925 X:20193437-20193459 ACAATGTAATATGATTGTTTAGG - Intronic
1188116028 X:26243824-26243846 CCAAAATAAAGGGATGGGTTTGG + Intergenic
1188298447 X:28479393-28479415 AAAAATTAAAAGAATTGTTTTGG - Intergenic
1188335117 X:28921901-28921923 CCAAAGTAAGAAGCTTGGTTTGG + Intronic
1188761460 X:34036476-34036498 ACACATAAAAAGGTTTGGTTAGG - Intergenic
1189233127 X:39467498-39467520 ACAAAATAAAAATATTAGTTGGG + Intergenic
1189397328 X:40634633-40634655 CCAAAGTCAGAGGATTTGTTAGG - Intronic
1190177222 X:48160638-48160660 AAAAATTAAATCGATTGGTTGGG - Intergenic
1190499255 X:51058939-51058961 AAATAGTACAAGGACTGGTTTGG - Intergenic
1191711924 X:64158929-64158951 ATAAAGAAAAAAGATTTGTTTGG - Intergenic
1191919421 X:66238888-66238910 CCAAAATAAAGGGATGGGTTGGG + Intronic
1192454283 X:71264531-71264553 ACAAAGTCAATTGATTAGTTAGG - Intergenic
1193254662 X:79333108-79333130 ACAAAAGAAAAAGATAGGTTGGG - Intergenic
1193556235 X:82957308-82957330 AATAAGTAATAGGATTGATTTGG + Intergenic
1193916001 X:87364627-87364649 ACAAAATAAAGGGATGGGTCTGG - Intergenic
1194756693 X:97746657-97746679 AGAAAGAAAAAGGTTTGATTGGG - Intergenic
1195466221 X:105182488-105182510 ACAAAGTAAAAGGATGGAAAAGG - Intronic
1195811353 X:108834313-108834335 ACACAGTAAATGGATTGGTTAGG + Intergenic
1195879310 X:109575971-109575993 ACAAAGAAAAGGGATTTATTTGG - Intergenic
1196647628 X:118134633-118134655 ACAAAATGGAAGCATTGGTTGGG - Intergenic
1197247100 X:124177435-124177457 ACAAAGCAAAAAGGTTGATTCGG - Intronic
1197980755 X:132216969-132216991 ACAAATTACAAGACTTGGTTTGG + Intronic
1198822973 X:140668451-140668473 AAAAATTAAAAGGATTGGCTGGG - Intergenic
1199033867 X:143029988-143030010 ACAAAGTAAAGGGCTTAGTGGGG + Intronic
1199074560 X:143513283-143513305 ACAAAGTAACGGGCTTGGTGAGG - Intronic
1199093564 X:143716555-143716577 AGAAAGTAACAGGCTTGGTGAGG - Intronic
1199214767 X:145251605-145251627 ACAAAGTAAAGGGCTTGGTGAGG + Intronic
1199617633 X:149670583-149670605 ACATAGGAGAAGGATTGGGTCGG - Intergenic
1199625010 X:149732666-149732688 ACATAGGAGAAGGATTGGGTCGG + Intergenic
1199727365 X:150597794-150597816 AAAAAGAAAAAGGTTTGGTGCGG + Intronic
1202086898 Y:21147457-21147479 ACAAAGTACATTGATCGGTTAGG - Intergenic
1202112418 Y:21436315-21436337 ACAAAACAAAATGATTGGATGGG - Intergenic
1202164184 Y:21969231-21969253 CCAAAATAAAGGGATGGGTTTGG + Intergenic
1202227172 Y:22617141-22617163 CCAAAATAAAGGGATGGGTTTGG - Intergenic
1202315950 Y:23578513-23578535 CCAAAATAAAGGGATGGGTTTGG + Intergenic
1202554815 Y:26091554-26091576 CCAAAATAAAGGGATGGGTTTGG - Intergenic