ID: 1045982401

View in Genome Browser
Species Human (GRCh38)
Location 8:108206115-108206137
Sequence TGTCAACAAAGTAAAAGGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 308}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045982401_1045982404 16 Left 1045982401 8:108206115-108206137 CCAATCCTTTTACTTTGTTGACA 0: 1
1: 0
2: 1
3: 23
4: 308
Right 1045982404 8:108206154-108206176 CCAACCGTGTTAGATGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045982401 Original CRISPR TGTCAACAAAGTAAAAGGAT TGG (reversed) Intronic
903152862 1:21424950-21424972 GGTCAAAAAAGGAAAAGGATAGG + Intergenic
903206615 1:21787177-21787199 AGTAAACAAAGTTAAAGGAGAGG - Intergenic
906876409 1:49543370-49543392 CTACAACAAAGTGAAAGGATAGG - Intronic
907129291 1:52081136-52081158 TCTCAAAAAAATAAAAGAATAGG - Intronic
907534767 1:55141361-55141383 TGTCCACCAGGTAGAAGGATAGG + Intronic
908331952 1:63079862-63079884 TGTCAGCAAAGGAAAAAAATGGG + Intergenic
909927939 1:81460685-81460707 TGTTAATAAAGTAAAAGGGGTGG - Intronic
911491314 1:98570751-98570773 TATAAAAAAAGTAAAAGGGTAGG + Intergenic
911672405 1:100621734-100621756 TATCAACAAAGCAAAAGGTCAGG - Intergenic
911718046 1:101158161-101158183 TGACAACAGGGTAAAGGGATAGG - Intergenic
911786114 1:101950264-101950286 TGTGAAGAAAGCAAGAGGATGGG - Intronic
913179223 1:116303477-116303499 TGGCAACAAAGATAGAGGATGGG + Intergenic
913367722 1:118060428-118060450 TGTCAATAACGTAAAATGTTGGG - Intronic
913378067 1:118176812-118176834 TTTCAACAAATTAAAAAGAGTGG + Intronic
916476791 1:165177238-165177260 TTTCTATAATGTAAAAGGATGGG + Intergenic
917545831 1:175966815-175966837 TATCAACAGAGGAAAAGGCTTGG + Intronic
918898974 1:190387733-190387755 TGTTATCAAAGTAAAAAGAGAGG - Intronic
919983645 1:202658099-202658121 TATTAATAAACTAAAAGGATTGG + Intronic
920775327 1:208931189-208931211 TGTGGACAAAGAAAGAGGATAGG + Intergenic
921228436 1:213044241-213044263 TGTCAACAAACAAAAAGCCTGGG - Intergenic
923112815 1:230905805-230905827 TCTCAAGAAAGGAAAAGGCTAGG + Intergenic
923317065 1:232790928-232790950 TTTCAAAAAAGCAAAATGATAGG - Intergenic
924284209 1:242469309-242469331 TATCAAAAAAGAAAAATGATTGG - Intronic
1063812745 10:9732472-9732494 TGCCAACAAAGAAAAAGCAAAGG - Intergenic
1065460037 10:25951060-25951082 TGTCAATTAATTAAAAGAATAGG - Intronic
1066314853 10:34234498-34234520 TGTGGACAAAGCAAAAGGCTGGG - Intronic
1068983968 10:63090091-63090113 TGTCAATTAAGAAAAAGTATTGG + Intergenic
1070456570 10:76623054-76623076 TGTCAGCAAAGTCAAAGGCAGGG - Intergenic
1070716215 10:78723783-78723805 TTTCAACAATGAAAAAGGAATGG + Intergenic
1071328406 10:84538829-84538851 TGTCAACAATGGGAAAGGAGGGG + Intergenic
1071760981 10:88606319-88606341 TGTCAATAAATTATAAGTATTGG - Intronic
1072348465 10:94532674-94532696 TGTTAGGAAAGTAAAAGCATTGG + Intronic
1074345289 10:112679186-112679208 TGTAAACAAAGTAAGTGGCTGGG + Intronic
1076668352 10:132105339-132105361 TGGGAATAAAGGAAAAGGATGGG + Intronic
1077598474 11:3555218-3555240 GGACAACAAAGCAAAAGCATTGG + Intergenic
1077779347 11:5308568-5308590 TGTCAACTAAACAAAACGATAGG + Intronic
1078019677 11:7645484-7645506 TGTCAACAAAACAAATGGTTTGG + Intronic
1079599477 11:22293421-22293443 TATAAACAAAGTAAAAGGAAGGG + Intergenic
1079790633 11:24734291-24734313 TATCAACAAACTAAGAGAATAGG - Intronic
1080182179 11:29438567-29438589 TATAAAGAAAGTTAAAGGATTGG + Intergenic
1080986630 11:37474826-37474848 TGTCAACAAAGAAAATAGAGGGG - Intergenic
1081470028 11:43361086-43361108 TATAAATAAAGTAAAAGAATTGG + Intronic
1082621428 11:55427744-55427766 TGTGAAAAAAGTAACAGAATTGG + Intergenic
1084254551 11:67931093-67931115 GGACAACAAAGCAAAAGCATTGG + Intergenic
1084818320 11:71664790-71664812 GGACAACAAAGCAAAAGCATTGG - Intergenic
1087215917 11:95494452-95494474 TAAAAACAAAGAAAAAGGATTGG - Intergenic
1090757511 11:129805624-129805646 TATAAACAAAGTAAAGGGGTGGG + Intergenic
1092424622 12:8364572-8364594 GGACAACAAAGCAAAAGCATTGG + Intergenic
1092882940 12:12901878-12901900 TGTAACCAAAGTCAAAGGACGGG - Intronic
1093343888 12:18016437-18016459 TGTCAACAAAGCAGCAGGATTGG - Intergenic
1093457830 12:19382063-19382085 CGAAAACAAAGTAAAAGGCTGGG + Intergenic
1093578016 12:20757181-20757203 TCTCAACAATGTAAAAGTAAAGG - Intergenic
1095593719 12:43935951-43935973 TGGAAACAGAGTGAAAGGATGGG + Intronic
1095670681 12:44856708-44856730 GGTCAGAAAAGTAAAAGGGTGGG + Intronic
1096339804 12:50788182-50788204 TGTCAAAAAAAAAAAAAGATTGG - Intronic
1096914613 12:55017789-55017811 TGTCAGCAAAGGAAAAGGGGTGG - Intergenic
1098220257 12:68262825-68262847 TGTCCACAAATTAAGAGGAGAGG - Intergenic
1098493515 12:71109646-71109668 TGTACACAAAATATAAGGATGGG + Intronic
1098507191 12:71266455-71266477 TGTCTAGAAAATAAAACGATTGG - Intronic
1098824203 12:75272407-75272429 TGTGAACAAAGTAAAATGGTTGG - Intergenic
1099429083 12:82559339-82559361 AGTCAACAAACTAACAGGCTGGG - Intergenic
1100020689 12:90066059-90066081 TTTCCACAAAATAAAGGGATGGG + Intergenic
1100539758 12:95547581-95547603 TGTAAACAAGGAAAAAGAATGGG - Intronic
1101509325 12:105378955-105378977 TGTCATTAAAGTCAAATGATTGG + Intronic
1101893125 12:108732998-108733020 ACTCAACAAAATGAAAGGATGGG + Intergenic
1103692748 12:122788913-122788935 AGTCAACAAACTAAAAGGTAAGG + Exonic
1104474776 12:129062194-129062216 TGCCACCAAAGTTAAAGGGTTGG - Intergenic
1105389570 13:19962009-19962031 TCCCAACAATTTAAAAGGATAGG - Intronic
1106790662 13:33152361-33152383 TGTCAGCAAAGTAGTAGCATGGG - Intronic
1109011405 13:56951181-56951203 TATCACCAAAGTAAATGAATTGG + Intergenic
1110062414 13:71059247-71059269 TTTCAACAAGGAAAAAGGCTTGG - Intergenic
1110297616 13:73886689-73886711 TGTAAAGAAAATAAAAGTATAGG + Intronic
1110347088 13:74461160-74461182 TGTGAAGAAAGAGAAAGGATTGG - Intergenic
1111660075 13:91198678-91198700 TGTCATCTTAGTAAAAGGATAGG + Intergenic
1111939012 13:94589147-94589169 TGTCAAAAAAGTGAGAAGATAGG + Intronic
1112752228 13:102594968-102594990 TGTCAAAAAAGAAAAAGAAAAGG + Intergenic
1113373469 13:109742917-109742939 TGTCAAGAAAGAAAGAGGAAAGG + Intergenic
1113704747 13:112421247-112421269 TGTCAACAAAGCAAAAAGGAGGG + Intronic
1114131497 14:19798475-19798497 TGGCAACAAAGTAAAGTGAGTGG + Intronic
1115902732 14:38171646-38171668 TGTCAATGAAGTAAAAAAATAGG - Intergenic
1116168694 14:41369950-41369972 TGGCAAAAAAGTAAAAGTAATGG - Intergenic
1116217740 14:42041700-42041722 TCTCAACAAAGAAAAAAGCTTGG - Intergenic
1116728965 14:48598035-48598057 TGCCAAAGAAATAAAAGGATGGG + Intergenic
1117831722 14:59758071-59758093 TGTGTAGACAGTAAAAGGATCGG - Intronic
1119381064 14:74228587-74228609 TGTTAAGAAAGTAAAGGAATAGG - Intergenic
1124445950 15:29732290-29732312 TCTCACCAAATTAAAAGAATGGG + Intronic
1124925293 15:34064551-34064573 TGCCAATGAAGTAAAGGGATAGG + Exonic
1125926041 15:43563997-43564019 TGTCAACACAGTGGAAGGAGAGG + Intronic
1125939185 15:43663548-43663570 TGTCAACACAGTGGAAGGAGAGG + Intronic
1126504357 15:49387009-49387031 TGTCAACAAAATAAAAGCCCAGG + Intronic
1127169016 15:56279236-56279258 TCTCAACAAAGTATAAAGGTTGG - Intronic
1127297734 15:57624578-57624600 TGTCATCAAAGCCAAAGAATTGG + Intronic
1128004282 15:64224144-64224166 TATAAACAAAGCAAAAGAATGGG - Intronic
1128211228 15:65904248-65904270 TCTCAAAAAGGTATAAGGATTGG - Intronic
1128676861 15:69616008-69616030 TGTCACCAAAGCAAAAGGGGAGG + Intergenic
1130773970 15:86957424-86957446 TGTCAACAAAGTAAAATCTCAGG + Intronic
1130814114 15:87412748-87412770 TGGCAACATATTAAAAGCATAGG + Intergenic
1133373627 16:5265426-5265448 GGACAACAAAGCAAAAGCATTGG - Intergenic
1133716087 16:8450492-8450514 TGTAAACCAAGTAAAATGACTGG + Intergenic
1134432702 16:14226038-14226060 TTTCAACAATGCAAAAGGAGAGG + Intronic
1136046634 16:27620371-27620393 TGCAGACAAAGTAAAATGATGGG - Intronic
1138781654 16:59795875-59795897 TGTCAGGAAAGTAAATGAATTGG + Intergenic
1140161408 16:72498495-72498517 TGTCAAGGATATAAAAGGATTGG - Intergenic
1143008449 17:3852276-3852298 TGGCTACAATGTAGAAGGATGGG - Intergenic
1144444881 17:15317731-15317753 TGTCAGCATAGGAAAAGTATTGG - Intronic
1144591600 17:16528714-16528736 TGTCAACAAAGTCAGAGAAGAGG + Intergenic
1145346213 17:22042877-22042899 TTCCAAAAAAATAAAAGGATAGG - Intergenic
1146576894 17:34001912-34001934 TGTCAACAAAATGAAGGGATAGG - Intronic
1146755285 17:35426242-35426264 AATCAACAGAGTAAAAGAATAGG - Intronic
1147531326 17:41280828-41280850 TGTCAACAAAGTCAGGGGAGTGG - Intergenic
1147876656 17:43626496-43626518 AGTCAAGAAAATAAAAGGCTGGG - Intergenic
1149404272 17:56330974-56330996 TGTCATCATTGTAATAGGATTGG + Intronic
1155492405 18:26412551-26412573 TTTCAACAATGTTAAAGTATTGG - Intergenic
1155844337 18:30686637-30686659 TGTAAAAAAATTAAAAGGATAGG - Intergenic
1155865683 18:30962188-30962210 TGTCTACAAAATAAAAAAATTGG + Intergenic
1157294001 18:46428918-46428940 TGTCTATAAAGGAAAAGAATGGG - Intronic
1157810461 18:50691797-50691819 TGTCAAGAGAATAAAAGTATCGG + Intronic
1157989493 18:52477835-52477857 TGGGAACAAAGTAAAAAGTTAGG - Intronic
1157991703 18:52504325-52504347 TCACAGCAAAGTAAAAGGATGGG + Intronic
1158332502 18:56378244-56378266 TGTAAGAAAAGTAAAAGGATTGG - Intergenic
1159489567 18:69113540-69113562 AGTCTACAAAATGAAAGGATTGG + Intergenic
1162318286 19:9954596-9954618 TTTCAAAAAAATAAAAGGCTGGG + Intergenic
1163211040 19:15840538-15840560 TATTAAGAAAGCAAAAGGATGGG + Intergenic
1164759591 19:30719112-30719134 TGTAAACAAAGAAAAAGGCAGGG - Intergenic
1165874126 19:38993662-38993684 TCTCAAAAAAAAAAAAGGATGGG - Intronic
1166639023 19:44478617-44478639 TGTGAACAAAAGAAAAGGAATGG + Intronic
1167724960 19:51204968-51204990 TATCAAGAAAGTAAAAAGAATGG + Intergenic
1167803388 19:51761535-51761557 TGTTAAAAAAGTAAAATCATTGG - Intronic
925563272 2:5221542-5221564 TGTGACCAACGTAAAAGAATAGG - Intergenic
926808142 2:16731487-16731509 AGTCAAGAAAGAAAAAAGATAGG - Intergenic
927344383 2:22020479-22020501 TGTAAACTTAGTAATAGGATAGG + Intergenic
927363482 2:22265174-22265196 AGGCCAAAAAGTAAAAGGATAGG - Intergenic
928619722 2:33076535-33076557 TCTCAAAAAAAAAAAAGGATGGG - Intronic
928799108 2:35065434-35065456 TGTCGACAAAGTACCAGGAAGGG + Intergenic
928910962 2:36420442-36420464 AGACAATAAAGTAACAGGATTGG - Intronic
929283748 2:40112739-40112761 TGCCAACAAAGATAAAAGATGGG + Intronic
929998800 2:46847217-46847239 TGTTAATAAAATAAAGGGATTGG - Intronic
931317599 2:61147217-61147239 TGTCAAAAAAAAAAAAGGAAAGG - Intronic
931586042 2:63829717-63829739 TATCAACAATGTAAAAGTACTGG - Intergenic
931684094 2:64778425-64778447 TGTCAGAGAAGTAAAAGGAGGGG + Intergenic
931861106 2:66355587-66355609 TGTCTAGAAAGTAAAAAGTTTGG - Intergenic
932871198 2:75400188-75400210 TATCAAAAAAGTAAAATGCTTGG + Intergenic
933119855 2:78523023-78523045 TGTCAAGAAAGGAAAGGGAGTGG - Intergenic
933133066 2:78697832-78697854 TGTCAATAAAATAAAAGGAGGGG - Intergenic
933920704 2:87042102-87042124 AGTTAACAAAGTATAGGGATTGG - Intergenic
933930921 2:87151684-87151706 AGTTAACAAAGTATAGGGATTGG + Intergenic
934002294 2:87727796-87727818 AGTTAACAAAGTATAGGGATTGG + Intergenic
936345094 2:111669704-111669726 TGTGAACAGACTAAATGGATGGG - Intergenic
936362202 2:111813759-111813781 AGTTAACAAAGTATAGGGATTGG - Intronic
937799570 2:126066005-126066027 TAGCAACAATGTAAAAGGACTGG - Intergenic
938959145 2:136325245-136325267 TGTCAACATTGCAAAATGATAGG + Intergenic
939007063 2:136801454-136801476 TGTCAAGAAAGCAAAATGATAGG + Intronic
939477719 2:142707702-142707724 TGGCAACAAAGAAAAAGTAGAGG + Intergenic
939572071 2:143852342-143852364 TGTAAACAGAGTATAAGGATTGG + Intergenic
939840477 2:147182024-147182046 TGTCAACAAGATAGAAGAATAGG + Intergenic
940023770 2:149183365-149183387 TGTCATCAGAATAAATGGATGGG - Intronic
940556191 2:155231865-155231887 TATGAACAAAGAAAAAGTATTGG - Intergenic
940601112 2:155861616-155861638 TGTAAAAATAGCAAAAGGATGGG + Intergenic
941331696 2:164185585-164185607 TGTCAGCAAAGTAAACAGCTGGG + Intergenic
941623036 2:167800188-167800210 TGTCCACGAAATAAAATGATGGG - Intergenic
941756547 2:169192683-169192705 TGTCCACAAAATAAAAGAACAGG + Intronic
943009600 2:182431250-182431272 TGTCAAAAAAGAGAAAAGATTGG - Intronic
943205853 2:184894519-184894541 TAGCAAAAAAGTAAAAGGAAGGG - Intronic
943342006 2:186693478-186693500 TTTGAACAAATGAAAAGGATAGG + Intergenic
943472351 2:188310186-188310208 TTTAAACAAAATAAAAGGAAGGG + Intronic
944727347 2:202484669-202484691 TCTCAAAAAAGAAAAAGGCTGGG + Intronic
945696709 2:213115632-213115654 TAACAATAAATTAAAAGGATAGG + Intronic
946544699 2:220725811-220725833 TGTCAACAATTTAAATGCATTGG + Intergenic
947527099 2:230884806-230884828 TGTCTACAAAGCACAAGGCTGGG - Intergenic
948761249 2:240192669-240192691 TGTAAACAAAGGAAATGGTTTGG + Intergenic
949063865 2:241977447-241977469 TTTCAAAAAAACAAAAGGATGGG - Intergenic
1168986651 20:2054865-2054887 TCTCAACTATGTAAAAAGATAGG + Intergenic
1169817459 20:9672786-9672808 TGTGGGCAAAGTAAAAGGAAAGG - Intronic
1170195837 20:13688803-13688825 TGTCTTAAAAGTAAAAGGAGAGG + Intergenic
1170251072 20:14283313-14283335 TGTCACAAATGTAAAAGGAAGGG - Intronic
1171119317 20:22554789-22554811 TGACAACATAGTAAAAGTATTGG - Intergenic
1173422461 20:42914694-42914716 TGACAACAAAGGAACAGCATGGG + Intronic
1174934210 20:54849862-54849884 TGTCAACAAAGCATAAGGCAAGG - Intergenic
1177716150 21:24841613-24841635 TGGCAACAAAGAAAAAGTAGCGG + Intergenic
1178266803 21:31150776-31150798 TGTCAAGAAAATGAAAAGATGGG + Intronic
1179375046 21:40842508-40842530 TGTTTGCAAAATAAAAGGATGGG - Intronic
1180254398 21:46614213-46614235 TATCAACAAAGTAAACAGAATGG - Intergenic
1181585522 22:23850821-23850843 TGTCTACATAGTAAAAGCCTGGG - Intergenic
950751979 3:15136620-15136642 GGACAACAAAGCAAAAGCATTGG - Intergenic
951131254 3:19048000-19048022 TGTCAAAAATGTTAAAAGATTGG + Intergenic
952025933 3:29082344-29082366 TGTAAAAAAAGTAGAAGGATAGG + Intergenic
952093108 3:29915170-29915192 TGTCAATAAAGTAAAAGAAATGG - Intronic
952564042 3:34634051-34634073 TATCTACAAAGTAACATGATGGG + Intergenic
953311245 3:41881856-41881878 TGTCAACAAAGTACAACAACTGG + Intronic
953646815 3:44763132-44763154 TGCCAACAAACTTAAAGGAGTGG - Intronic
953934330 3:47027046-47027068 TATCAAGAAAGAAAATGGATTGG + Intronic
954252820 3:49381569-49381591 TGTCAAAAAAAAAAAAGGATTGG + Intronic
955237577 3:57153151-57153173 TCTCAATAAAGTAAAAGGGAAGG + Intronic
956705980 3:71999485-71999507 TGTCAATAAAGTCAAGGAATTGG - Intergenic
958917385 3:100064830-100064852 TTTCCACACAGTAAAAAGATTGG + Intronic
961284783 3:125792612-125792634 GGACAACAAAGCAAAAGCATTGG - Intergenic
963422896 3:145084389-145084411 TTTCAACAAAGAAAAACAATTGG - Intergenic
963621024 3:147606754-147606776 ACTCAGCAAAGTAGAAGGATTGG + Intergenic
965027591 3:163323127-163323149 TGACAACAAAATAAAAGTAGAGG - Intergenic
965049843 3:163632392-163632414 TGTGAAAAATGTAAAATGATGGG + Intergenic
965946414 3:174247579-174247601 TGTAAGTAAAGTTAAAGGATTGG - Intronic
966983389 3:185157980-185158002 TGTCTACAACATGAAAGGATTGG - Intergenic
967206103 3:187123412-187123434 TGGGAAGAAAATAAAAGGATTGG - Intronic
967795623 3:193595806-193595828 TGTCTAGAAAGAAAAAGGACAGG - Intronic
968116451 3:196094077-196094099 TGTGAAGAATATAAAAGGATTGG + Intergenic
968144848 3:196289376-196289398 TGTGGACAAAGAAAATGGATGGG + Intronic
968529295 4:1082120-1082142 TCTCAAAAAAGGAAAAGGAAGGG + Intronic
969740887 4:9025544-9025566 GGACAACAAAGCAAAAGCATTGG - Intergenic
970251254 4:14118451-14118473 TGACAAAATAGTAAAAGGATAGG + Intergenic
971249386 4:24960538-24960560 TGTAATAAAAGTAAAGGGATGGG + Intronic
971706864 4:30056289-30056311 TGTCAACAAAGCAAGAGCTTGGG + Intergenic
973800694 4:54474887-54474909 TTTTTACAAAGGAAAAGGATAGG + Intergenic
975054224 4:69907939-69907961 TGTCATTAAAGGGAAAGGATAGG + Intergenic
975607898 4:76174090-76174112 TGTCAAGAATGCAGAAGGATTGG - Intronic
975969489 4:80016364-80016386 TGTCAGCAAAGAAAGGGGATGGG - Intronic
977311353 4:95391690-95391712 TTTGAACAAAGTTAAGGGATTGG - Intronic
979821583 4:125180074-125180096 TGTTAACAGAGGAAAAAGATAGG - Intergenic
980536732 4:134134062-134134084 TTTCAACAATATAAAAGTATTGG + Intergenic
980885802 4:138761026-138761048 TTTCAAGAATGTAAAAGGAAAGG + Intergenic
980982447 4:139666068-139666090 TGTCAGCAAAGTAAGAGGCATGG + Exonic
981602259 4:146503468-146503490 TGTTAACAAACTAAATTGATGGG - Intronic
981972153 4:150676576-150676598 TGTCAACAAACTTCAAGGCTGGG + Intronic
982057318 4:151565042-151565064 TATCAACACAGTAATAGGAAGGG - Intronic
982329922 4:154169907-154169929 TGTCAAGAAAAAAAAAGGCTGGG - Intergenic
983808520 4:172026321-172026343 TGACATCAAAGTAAGAGGCTGGG - Intronic
986073390 5:4309970-4309992 TGTAAACAAAGTAAAAGTCAGGG + Intergenic
986544584 5:8881185-8881207 TGTGAAAAAGGTAAGAGGATTGG - Intergenic
988836642 5:35039137-35039159 TGTCAAGAAAGGAAAAGTAAGGG + Intronic
989079840 5:37606940-37606962 TGTCAAAAAAGAAAGGGGATGGG - Intronic
989554715 5:42780443-42780465 AGTCAATATATTAAAAGGATTGG - Intronic
990304844 5:54483796-54483818 TTTCAAAAAAATAAAAGGAAGGG - Intergenic
990793399 5:59510009-59510031 TTTCAACAATGTCAAAGAATAGG + Intronic
992306898 5:75450031-75450053 TACCAAGATAGTAAAAGGATTGG - Intronic
992544489 5:77798452-77798474 TGTTAACAAAGTAAATGAAAGGG + Intronic
993718361 5:91297519-91297541 TATTAAGAAAGTAAAAGGCTGGG + Intergenic
993813151 5:92508565-92508587 TGAGAACAATGTCAAAGGATTGG - Intergenic
993951296 5:94179067-94179089 TCTTAACAAAGCAAAAGCATAGG + Intronic
996236013 5:121129791-121129813 TGTTAAAAAAAAAAAAGGATAGG - Intergenic
996656214 5:125940253-125940275 TATGAAGACAGTAAAAGGATTGG + Intergenic
997094611 5:130897073-130897095 AAACAAAAAAGTAAAAGGATGGG + Intergenic
999014915 5:148092067-148092089 TGTCAGCAAAGTAAAGAGGTTGG + Intronic
1002371531 5:178758883-178758905 TGTTAAGAAAGTAATAGGCTGGG + Intergenic
1003631029 6:7787467-7787489 TGTCAAAAAAGTACATGAATGGG - Intronic
1004511817 6:16289402-16289424 TGTCAAAAAAGTAAAAACGTGGG - Intronic
1005361411 6:25034889-25034911 TGTCAAGGAAGAAAAATGATGGG - Intronic
1005462740 6:26084522-26084544 TGTCAAAAAAAAAAAAAGATAGG + Intergenic
1005807196 6:29486016-29486038 TTTCTTCAAAGTAAAAGGTTTGG + Intergenic
1006205144 6:32334493-32334515 TCTCAAAAAAATAAGAGGATGGG - Intronic
1007018136 6:38490270-38490292 TGTCAACAAAATGAAAGGTATGG + Intronic
1007867026 6:44982826-44982848 AGTCAAGAAAATAAAAGGATAGG + Intronic
1008617330 6:53239397-53239419 TGTCTACAAAGTAAAAGGGTTGG + Intergenic
1009392497 6:63161246-63161268 TAGCAAGGAAGTAAAAGGATTGG + Intergenic
1010988695 6:82454866-82454888 TATCAACAGAGTAAAAAGAATGG - Intergenic
1011097808 6:83685576-83685598 TGTCAACATAGGAAAAGGCAAGG - Intronic
1011540919 6:88427682-88427704 TGTCATCAAAGAAAAAGAAGAGG - Intergenic
1011704978 6:89992094-89992116 TGGCAACAGAGTGAAAGGTTTGG - Intronic
1011985806 6:93443800-93443822 TGTCCAAAAACTAAAAGGAGAGG - Intergenic
1012400340 6:98836978-98837000 TCTTACCAAAGCAAAAGGATTGG + Exonic
1013193705 6:107826545-107826567 TGTAAAAGAAGTAAAAGGGTTGG + Intergenic
1014474568 6:121856530-121856552 TGTCAAGAACTCAAAAGGATGGG + Intergenic
1014664988 6:124226715-124226737 GGTCAAAAAAGTAAAGAGATTGG - Intronic
1016645341 6:146400562-146400584 TCTCAAAATAGAAAAAGGATAGG - Intronic
1017167107 6:151419063-151419085 TCTCAAAAAAGAAAAAGGCTGGG - Intronic
1017678479 6:156839613-156839635 TGGCGTCAAAATAAAAGGATGGG + Intronic
1017912837 6:158809115-158809137 TGGCAGCAAAGCAAGAGGATAGG - Intronic
1018325229 6:162660712-162660734 ATTCAACAAAGTAAAGAGATGGG + Intronic
1019005315 6:168791728-168791750 TGTCAGAAAAGTAAAAGTTTTGG - Intergenic
1019646539 7:2132579-2132601 TGTGGACACAGTAAAAAGATCGG - Intronic
1020450632 7:8316842-8316864 TCTCAACAAAGTAGAAGTATAGG - Intergenic
1021893106 7:25206678-25206700 TGTCAAGATAGAAAAATGATAGG + Intergenic
1023992595 7:45138015-45138037 TGAGAACAAAGTGATAGGATGGG - Intergenic
1026348296 7:69494028-69494050 TGTCAAGATAATAAAAGGCTGGG + Intergenic
1026989850 7:74578474-74578496 TGTCATAAAAGTAAAATTATAGG - Intronic
1027365339 7:77451640-77451662 TGTAAACAAATTAAAAGAATGGG - Intergenic
1028867385 7:95729416-95729438 GCTCAAAAAAGTAAAAAGATTGG + Intergenic
1029071617 7:97903859-97903881 GGACAACAAAGCAAAAGCATTGG + Intergenic
1029102697 7:98146658-98146680 TGACAACAACATAAAGGGATGGG - Intronic
1030456893 7:109785923-109785945 TTGGAAGAAAGTAAAAGGATGGG - Intergenic
1030614064 7:111719263-111719285 TCTCAACAAAGTAAACAGAATGG - Intergenic
1034261929 7:149762610-149762632 TGTGAAAAAAGCAAAAGGTTTGG - Intergenic
1035700105 8:1631894-1631916 TGTCAGCAGAGTAAAAGGCAAGG - Intronic
1035752454 8:2005853-2005875 TGTCAACTAAGCAAAAGGTCAGG - Exonic
1036246091 8:7118139-7118161 GGACAACAAAGCAAAAGCATTGG - Intergenic
1036254709 8:7196307-7196329 GGACAACAAAGCAAAAGCATTGG + Intergenic
1036362779 8:8091183-8091205 GGACAACAAAGCAAAAGCATTGG - Intergenic
1036530479 8:9581381-9581403 TGTCAAAAAACTGAAAGGACAGG - Intronic
1036888180 8:12575882-12575904 GGACAACAAAGCAAAAGCATTGG + Intergenic
1036895782 8:12634006-12634028 GGACAACAAAGCAAAAGCATTGG + Intergenic
1036974781 8:13398418-13398440 TGTCAAATAAGAGAAAGGATGGG + Intronic
1036984850 8:13517746-13517768 TGAAAACAAAGTATCAGGATAGG + Intergenic
1038316719 8:26490619-26490641 TATAAACAAAGTAACAGGTTGGG + Intronic
1038348300 8:26752417-26752439 TGGCAACAAAGAAAAGGGAAGGG + Intronic
1039348620 8:36735756-36735778 TCTCAAAAAAGAAAAAGGAAAGG - Intergenic
1040401741 8:47057315-47057337 TGGCAACAAAGAAAAAGTAGTGG + Intergenic
1041307349 8:56475325-56475347 TGTCAAAAAAGAAAAAGATTAGG - Intergenic
1041325949 8:56664806-56664828 TGTCAAGAAAGAAAAAAAATTGG - Intergenic
1041980830 8:63857114-63857136 TGTGAAAAAAGTAAAAGGAGAGG + Intergenic
1042870567 8:73394774-73394796 TGTTAAAAAAGTAAATAGATTGG + Intergenic
1043741576 8:83819687-83819709 TTTCAACAGAGCAAAAAGATAGG + Intergenic
1044022347 8:87120662-87120684 TATCAAAAAAGCAAAAAGATTGG - Intronic
1045982401 8:108206115-108206137 TGTCAACAAAGTAAAAGGATTGG - Intronic
1046338355 8:112820281-112820303 TATGAACAAAGTGAAAGGCTTGG + Intronic
1047025300 8:120816987-120817009 TGTCACCATTTTAAAAGGATTGG + Intergenic
1048659516 8:136581448-136581470 TCTCAAAAATGTAAAATGATTGG + Intergenic
1050501606 9:6304179-6304201 AGTACACAAAGTAAAAGGTTAGG - Intergenic
1052339004 9:27347032-27347054 AATAAACAAAGTAAAAGGAAAGG + Intronic
1058199084 9:102016631-102016653 TGCCAAAAAAATAAAAAGATAGG + Intergenic
1058780956 9:108334423-108334445 TGACAACAAACTAAAGGAATTGG - Intergenic
1059400221 9:114064907-114064929 TGTCAGGAAAGGAAAGGGATGGG - Intronic
1060831205 9:126718186-126718208 TTTCAACACAGAAAAAGGAGAGG - Intergenic
1060960849 9:127679517-127679539 AATCCACAAACTAAAAGGATGGG + Intronic
1185983320 X:4803599-4803621 TATCAAGAAAGTAAAGGAATAGG - Intergenic
1187292440 X:17968118-17968140 TGTAAACAAAGGAATAGGCTGGG + Intergenic
1187866309 X:23726367-23726389 TGTCACCAAAGCCCAAGGATGGG + Intronic
1187924850 X:24240262-24240284 TATCAAGAAAGTGAAAAGATGGG + Intergenic
1188503568 X:30855886-30855908 TCTCAACAAATTAAAATGTTGGG + Intronic
1188988832 X:36792251-36792273 TTTTAACCAAGTAAAGGGATGGG - Intergenic
1189259236 X:39666390-39666412 TGTCAACAAGGAAACAGGCTGGG + Intergenic
1189915986 X:45856306-45856328 TCTCAAAAAAATAAAATGATAGG + Intergenic
1190625376 X:52332281-52332303 TATGAAGATAGTAAAAGGATTGG - Intergenic
1191632931 X:63343013-63343035 TGTCAACAAAATGAAAGAGTAGG + Intergenic
1192971134 X:76231867-76231889 TGTCATCAATTTAAAATGATGGG + Intergenic
1193203700 X:78722725-78722747 TGTTTAAAAAGTAATAGGATTGG + Intergenic
1193568055 X:83104544-83104566 TCTCATCAAAGGAAAAGGCTGGG - Intergenic
1196133267 X:112180622-112180644 GGTCCTCAAAGTATAAGGATGGG - Intergenic
1197067678 X:122253382-122253404 TGTCAACAAAGTTATATGAAAGG + Intergenic
1197650742 X:129060841-129060863 TGTCAAAAATGGATAAGGATGGG + Intergenic
1197895990 X:131316068-131316090 TTTAAGAAAAGTAAAAGGATTGG - Intronic
1197955594 X:131943940-131943962 TGTCAACAAAATAACAGCATTGG + Intergenic
1198822975 X:140668456-140668478 TTTTAAAAAATTAAAAGGATTGG - Intergenic
1199361220 X:146921292-146921314 TGTCAAAAAACCAAAAGCATGGG + Intergenic
1199502175 X:148518985-148519007 TCTCAAAAAATTAAAAGGATTGG + Intronic
1201256626 Y:12113932-12113954 TGTCTACAAAGTAAGGGGAGAGG + Intergenic