ID: 1045982402

View in Genome Browser
Species Human (GRCh38)
Location 8:108206120-108206142
Sequence GTAAATGTCAACAAAGTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 505
Summary {0: 1, 1: 0, 2: 5, 3: 40, 4: 459}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045982402_1045982404 11 Left 1045982402 8:108206120-108206142 CCTTTTACTTTGTTGACATTTAC 0: 1
1: 0
2: 5
3: 40
4: 459
Right 1045982404 8:108206154-108206176 CCAACCGTGTTAGATGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045982402 Original CRISPR GTAAATGTCAACAAAGTAAA AGG (reversed) Intronic
901798973 1:11696278-11696300 GTAAATGTTTATAAAGTAAATGG - Intronic
902538465 1:17135588-17135610 TTAAATATCAACAAAGGAAAAGG + Intergenic
903864424 1:26387989-26388011 GTCAATGTCAGTCAAGTAAATGG - Intergenic
904837941 1:33350744-33350766 ATAAATGTAAACAAAGAAGATGG - Intronic
906425982 1:45712973-45712995 ATAAATGCCAACTAATTAAAAGG + Intronic
907061226 1:51427742-51427764 GTAAATGTCAGGTAAGAAAATGG + Intronic
907631074 1:56082574-56082596 TTAAATGTCTACAAAGTTTAGGG - Intergenic
907952047 1:59193027-59193049 GTAAATTTCAAATAAATAAAAGG + Intergenic
907952180 1:59194325-59194347 GTGAATGTTAACAAGGCAAAAGG - Intergenic
907999546 1:59666987-59667009 GACAATGTCAACACAGTTAATGG - Intronic
908082267 1:60593846-60593868 ATAAATGTGAATAAAATAAACGG - Intergenic
908130316 1:61068642-61068664 GTCAATGCTAGCAAAGTAAATGG + Intronic
908449538 1:64238704-64238726 GCAAATGTCATCAAGCTAAAAGG + Intronic
908917623 1:69149212-69149234 GGAAATGTCTTCATAGTAAATGG - Intergenic
909577975 1:77196770-77196792 GAAACTATCAACAGAGTAAACGG - Intronic
909783502 1:79580359-79580381 GTCATTTGCAACAAAGTAAATGG - Intergenic
910921883 1:92357288-92357310 TTAAATGCCAAAAAAGAAAAAGG + Intronic
911770385 1:101733448-101733470 TTAAATGTGAACAGAGTAATGGG + Intergenic
912589748 1:110804846-110804868 GAAACTATCAACAGAGTAAATGG - Intergenic
912965513 1:114233218-114233240 GCAAATGGCAACACAGTGAAAGG - Intergenic
913180623 1:116317635-116317657 TTAAGTGGCAACAAAGTATAGGG + Intergenic
914291608 1:146279400-146279422 ATAGATTTTAACAAAGTAAATGG + Intergenic
914552652 1:148730183-148730205 ATAGATTTTAACAAAGTAAATGG + Intergenic
914819470 1:151089623-151089645 GTAAATTTTAAAAAAGAAAAAGG - Intronic
916934468 1:169613366-169613388 ATAAATTTCAAAAAAGAAAAGGG - Intronic
917228397 1:172808967-172808989 GGAACTATCAACAGAGTAAATGG - Intergenic
917661081 1:177177669-177177691 GTACATGTTAACCACGTAAAAGG + Intronic
917894192 1:179471735-179471757 CTAAATGTAAAGAAAGTGAAAGG - Intronic
918838953 1:189509327-189509349 GAAAATGCCAGAAAAGTAAAGGG + Intergenic
918898509 1:190380418-190380440 GAAGATGTCAACAAAGTAGATGG + Intronic
919019290 1:192083761-192083783 GTAAAAGTCATGTAAGTAAATGG - Intergenic
921027681 1:211302657-211302679 GTAAATGGTAAGAAAATAAAAGG - Intronic
921247369 1:213258766-213258788 AGAAATGTTAGCAAAGTAAAAGG - Intronic
922300431 1:224294546-224294568 TTAAATGTCAAATATGTAAAAGG + Intronic
923438056 1:233987365-233987387 GTAAATCTCAATCAAGAAAAGGG - Intronic
923663771 1:235980920-235980942 GCAAAAGAAAACAAAGTAAAGGG + Intronic
923931272 1:238700604-238700626 GTAAATGCCACCAAAGTATTTGG + Intergenic
924463278 1:244278491-244278513 GAAACTATCAACAGAGTAAATGG - Intergenic
1063528140 10:6803531-6803553 GGAAATGTAAACAAGGCAAATGG + Intergenic
1063850522 10:10184289-10184311 GTAATGGTGAACAAAGTCAATGG - Intergenic
1063856019 10:10254966-10254988 GTAACTGTCATCAAAGTATGGGG - Intergenic
1064490749 10:15853373-15853395 GTGAATGTCAACACAGCGAAAGG - Intronic
1064713950 10:18156102-18156124 GAAAAAGGCTACAAAGTAAAAGG + Intronic
1064981568 10:21172216-21172238 GTGATCGTCAACAAAGTACATGG + Intronic
1065200679 10:23310204-23310226 GACAATGACAACAAAATAAAAGG + Intronic
1065223487 10:23519741-23519763 GAAACTATCAACAGAGTAAACGG - Intergenic
1065240972 10:23703750-23703772 GTAAATGTAGAGAAAATAAAAGG + Intronic
1065635920 10:27733952-27733974 GTAAATGAAAACAAATTAATAGG - Intronic
1066490941 10:35893945-35893967 GAAACTATCAACAGAGTAAATGG + Intergenic
1066804025 10:39225161-39225183 GTAATTGTCAACTCAGTGAATGG + Intergenic
1067259708 10:44678664-44678686 GGAAATGATAACAAAGTCAATGG - Intergenic
1067968969 10:50947553-50947575 GTAAATGAGAACCAAGGAAAAGG - Intergenic
1068744348 10:60513298-60513320 GTCAAGGTTAACAAAGTAATTGG + Intronic
1068888870 10:62127457-62127479 GTAACTGTAATAAAAGTAAATGG + Intergenic
1070456572 10:76623059-76623081 TTCAATGTCAGCAAAGTCAAAGG - Intergenic
1070943565 10:80369432-80369454 GTAACTATCAACAGAGTAAACGG + Intergenic
1071592344 10:86886786-86886808 TTACATGTAAACAAAGGAAAAGG - Intronic
1074115986 10:110457875-110457897 GTAAATCTTAGAAAAGTAAAGGG + Intergenic
1075358709 10:121809639-121809661 GCAAATGTCAACAGGGAAAAGGG + Intronic
1075457007 10:122591454-122591476 GTAAATTGCAACAAAGACAAAGG - Intronic
1075461605 10:122620228-122620250 GTAAATTGCAACAAAGAGAAAGG - Intronic
1076036373 10:127201797-127201819 ATAAAGGTCAACAAAATAAAGGG - Intronic
1076054343 10:127359135-127359157 GCAAATGTCAAAAAAAAAAAAGG + Intronic
1076592393 10:131593128-131593150 GACACTGTCAACAGAGTAAAAGG - Intergenic
1076592710 10:131597828-131597850 GACACTGTCAACAGAGTAAAAGG - Intergenic
1078687300 11:13545455-13545477 GAAAATGTGAACCAAGTGAAAGG - Intergenic
1078987156 11:16607404-16607426 GTAAATGGCATTAAAGAAAAAGG + Intronic
1079590199 11:22174407-22174429 GTCTATGGCAACAAAGTAGAAGG + Intergenic
1079599475 11:22293416-22293438 AGAAATATAAACAAAGTAAAAGG + Intergenic
1079818136 11:25089054-25089076 GTAATTTTAAACAAAGTAACGGG - Intergenic
1079945397 11:26734710-26734732 GTAAATGACAACTCAATAAATGG + Intergenic
1079973282 11:27062145-27062167 GAAATTCTCAACAAAGAAAAAGG + Intronic
1080403417 11:31957573-31957595 GTAAATCTCAACCTGGTAAATGG - Intronic
1081068075 11:38573132-38573154 GTTAATGGCAAAACAGTAAATGG - Intergenic
1081073268 11:38636375-38636397 GTAAATGTAAAACTAGTAAAAGG - Intergenic
1082104500 11:48206482-48206504 GAAACTATCAACAGAGTAAATGG + Intergenic
1083364961 11:62136853-62136875 GCAAATGTCAACATAGTGAAAGG + Intronic
1085662861 11:78385384-78385406 ATAAATGTCAACAATGTGACAGG + Intronic
1086108953 11:83177919-83177941 CTAAATGTTAAAACAGTAAAAGG - Intronic
1086267378 11:85017398-85017420 GCAAATTTCAACAAAGTAGTAGG - Intronic
1086518081 11:87637307-87637329 GAAATTGACAACAAAGTGAAAGG - Intergenic
1086644380 11:89201689-89201711 GCAAATGTGAACACAGAAAAAGG + Intronic
1086748719 11:90463127-90463149 GTAGATCTCAAAAAAGTAGAGGG + Intergenic
1087246446 11:95843918-95843940 ATAATTGTTAACAATGTAAAGGG + Intronic
1087256420 11:95959954-95959976 GAAATTGTCAAGAAAGAAAAAGG + Intergenic
1087328281 11:96750023-96750045 GTAAATGTCATCTAAGTTACAGG + Intergenic
1088063524 11:105687017-105687039 GAAACTATCAACAGAGTAAATGG - Intronic
1088655842 11:111999225-111999247 GTAAATGGCAAGAAAGGAAGTGG - Intronic
1089426852 11:118384541-118384563 GCAAATGACTACAAAGCAAATGG + Intronic
1089718917 11:120393929-120393951 GTAAATTTCAATAAATTAAAAGG + Intronic
1090599570 11:128356478-128356500 GAAAACATCAATAAAGTAAATGG - Intergenic
1090729981 11:129562875-129562897 GAAAATGTCAGAAGAGTAAATGG + Intergenic
1092819803 12:12342726-12342748 GAAAATGTAAACAGAGAAAAGGG - Intronic
1093498318 12:19782242-19782264 GAAACTATCAACAGAGTAAATGG + Intergenic
1094361917 12:29639989-29640011 GTAAAAGCCAGCAAAGTAGAAGG + Intronic
1095363971 12:41379318-41379340 GAAAAGGTCAACAAAATGAAGGG - Intronic
1095562235 12:43579287-43579309 GTAACTGTGAACAAATTATAAGG + Intergenic
1095689648 12:45072475-45072497 GTAAATGTCAAGGAAGTATTGGG + Intergenic
1095832479 12:46602560-46602582 ATAAAAGTAAACAAAGTATAAGG - Intergenic
1097849597 12:64398486-64398508 GGAATGGTCAAAAAAGTAAAAGG + Intergenic
1098224344 12:68306435-68306457 GAAACTATCAACAGAGTAAACGG + Intronic
1098693631 12:73523018-73523040 GAAAATGTCAATAAAGAAACAGG + Intergenic
1098812106 12:75107670-75107692 TTAAACGTCAAAAGAGTAAAAGG + Intronic
1099095056 12:78364973-78364995 ATAAAAGGCAACAAAATAAAGGG - Intergenic
1099169064 12:79341946-79341968 GTGAAAGTTAACTAAGTAAACGG + Intronic
1099542102 12:83924881-83924903 TCAAATGTCAACAAAAAAAAGGG - Intergenic
1099981253 12:89606000-89606022 GTAAAAGACAACAAATTATAGGG + Intronic
1100656566 12:96652507-96652529 TGAAAAGTCAACGAAGTAAAAGG + Intronic
1100913920 12:99396212-99396234 TTAAATGTCAGAAAAGTTAAAGG + Intronic
1102140084 12:110607580-110607602 GTAAAAATCAACAGAGTGAAAGG + Intergenic
1103657366 12:122483909-122483931 GTAAATGGGAAGAAAGGAAATGG - Intronic
1104346197 12:128001385-128001407 GTAAAAGTCAAGAAAGCAAAAGG + Intergenic
1105562224 13:21504218-21504240 GGAAAACTCAACAAAATAAAAGG - Intronic
1105795327 13:23846243-23846265 GTAAATGTTGGCAAAATAAAGGG - Intronic
1106013440 13:25846314-25846336 GGAAATGTTAGCAAAGTAGAAGG + Intronic
1107230924 13:38109387-38109409 GAAACTATCAACAGAGTAAATGG + Intergenic
1107503283 13:41003002-41003024 GTAAATATTAAGAAAATAAAAGG - Intronic
1109011655 13:56956453-56956475 AAAATTGTCAAAAAAGTAAAAGG - Intergenic
1109245077 13:59944280-59944302 GAAAATCTTCACAAAGTAAATGG + Intronic
1109357090 13:61245465-61245487 GAAACTATCAACAGAGTAAATGG - Intergenic
1109374449 13:61472365-61472387 GATAATGTCAACAAACCAAAAGG - Intergenic
1109558877 13:64020753-64020775 GTAAATTGCAGCAAAGTAACGGG - Intergenic
1109561057 13:64050976-64050998 TTAAATTTTACCAAAGTAAATGG + Intergenic
1109715683 13:66219042-66219064 ATAAATGACCACCAAGTAAATGG - Intergenic
1109950161 13:69490945-69490967 GTAAAGGTAAACCAAGAAAAGGG - Intergenic
1110499582 13:76211176-76211198 GTAAATGTCAACAAGTGAAATGG - Intergenic
1110550393 13:76805360-76805382 GTAGATGTAATCAAATTAAAAGG - Intergenic
1110648600 13:77918083-77918105 ATCAATGTCTACAAGGTAAAGGG - Exonic
1111512424 13:89283595-89283617 GTAAATGTAAGCAAAGAAATAGG - Intergenic
1112101074 13:96190074-96190096 GTAAATGTTAAAAAGATAAATGG + Intronic
1112484155 13:99804672-99804694 ATAAATGTCAATATAGTAACTGG + Intronic
1112698774 13:101980336-101980358 GAAAATGTCAAAAAAAAAAACGG + Intronic
1113332219 13:109340607-109340629 GAAAATGCCAAGAATGTAAAGGG - Intergenic
1113671777 13:112180512-112180534 GTAAGTGTAAGCAAATTAAAAGG - Intergenic
1115879108 14:37894823-37894845 ATAAATGTCAGCAAAGCAAAGGG - Intronic
1116046896 14:39754445-39754467 GTAAAAGTCCAGAATGTAAAGGG - Intergenic
1116585856 14:46702697-46702719 ATAAATGTCCTCAAATTAAAAGG + Intergenic
1116829032 14:49699760-49699782 GATAATATCAAAAAAGTAAATGG + Intronic
1117085166 14:52193182-52193204 GCAAATTTAAAAAAAGTAAATGG + Intergenic
1117633153 14:57714461-57714483 GGAAAAGTCAACAAATAAAATGG - Intronic
1118215499 14:63804317-63804339 GAAACTATCAACAGAGTAAACGG - Intergenic
1119076624 14:71646584-71646606 TTAAATCTCAACAAAGTAAAGGG - Intronic
1120465965 14:84857912-84857934 ATAAATGTCCATAAAGTATATGG + Intergenic
1123392917 15:19895419-19895441 ATAAATCTCAAAAAACTAAAGGG - Intergenic
1123823833 15:24061012-24061034 GTAAGTGTCAACAGAATAAATGG + Intergenic
1123840718 15:24244437-24244459 CTGAATGGCAACAAATTAAATGG + Intergenic
1123869640 15:24557557-24557579 CTGAATGGCAACAAATTAAATGG + Intergenic
1124332114 15:28829707-28829729 CTCAATGTCAACAAAATTAATGG - Intergenic
1125223828 15:37371415-37371437 GAAATTACCAACAAAGTAAATGG - Intergenic
1125235880 15:37512876-37512898 GCAAATGTCAAGAAAAAAAAAGG + Intergenic
1125847071 15:42866022-42866044 GTAAATACAAATAAAGTAAATGG + Intronic
1126366730 15:47902458-47902480 GAGAATGACAACAAAGCAAAAGG + Intergenic
1126804326 15:52330793-52330815 TTAAATGTCCAAAAAGTAAGTGG + Intronic
1126993402 15:54410324-54410346 GAAACTATCAACAGAGTAAAGGG - Intronic
1127661127 15:61101300-61101322 GGAAATTGTAACAAAGTAAATGG + Intronic
1128421919 15:67500130-67500152 TAAAATATAAACAAAGTAAATGG + Intronic
1128676858 15:69616003-69616025 GAAAGTGTCACCAAAGCAAAAGG + Intergenic
1128825789 15:70715318-70715340 TTTATTCTCAACAAAGTAAAAGG + Intronic
1130719679 15:86374386-86374408 CTAAATGTCATAAAAGTAATAGG + Intronic
1131410501 15:92203447-92203469 GAAACTATCAACAGAGTAAATGG - Intergenic
1131570066 15:93525422-93525444 CTAAATACCAACAAAGTACATGG + Intergenic
1132052784 15:98623373-98623395 ATAAATATTAACAAAGCAAAAGG + Intergenic
1135900136 16:26450647-26450669 GTAAATCTCAATAAACTCAAAGG - Intergenic
1137603732 16:49773650-49773672 GTTGTTGTCAGCAAAGTAAAGGG + Intronic
1137852508 16:51760392-51760414 GCAAATGTCATCAAAGTGAAAGG - Intergenic
1137866691 16:51904758-51904780 GTAACTGTCAAAAAAAAAAAAGG - Intergenic
1138062007 16:53901670-53901692 GTAAATGTTCAGAACGTAAATGG + Intronic
1138888291 16:61108161-61108183 GTAAAAGAAAACAAATTAAAAGG - Intergenic
1138952088 16:61924954-61924976 GTAAATATCAACCAGGTAGAGGG + Intronic
1141357440 16:83361385-83361407 GAAACTATCAACAGAGTAAATGG - Intronic
1142912414 17:3106074-3106096 GTATATTTCAAAATAGTAAAAGG - Intergenic
1147876658 17:43626501-43626523 GTTAAAGTCAAGAAAATAAAAGG - Intergenic
1148261799 17:46190941-46190963 GTAACTGTTAGCAAAGAAAATGG + Intronic
1149021755 17:51975324-51975346 TTAAGTGTCAACAGACTAAATGG + Intronic
1150828833 17:68500364-68500386 GAAAATGAGAACAAAGTGAAAGG - Intergenic
1150899992 17:69263184-69263206 GAAACTATCAACAGAGTAAATGG - Intronic
1151670861 17:75571068-75571090 GTAGGTGTCAGCAAAGTACAGGG - Exonic
1153621838 18:6986649-6986671 GTAAATTTCAGCAAACTATATGG - Intronic
1153694415 18:7626103-7626125 GTGAATGTCATCAGAGGAAAAGG - Intronic
1153957459 18:10110107-10110129 GTGATTGTCAACAAAGTCAGTGG + Intergenic
1154235201 18:12599009-12599031 GAAAATGTGAATAAAGCAAATGG - Intronic
1156936671 18:42717057-42717079 CAAAATGTTTACAAAGTAAATGG - Intergenic
1156962121 18:43044831-43044853 GGAAATGTCAAGAAAGTAAAGGG - Intronic
1158258616 18:55583495-55583517 TTAAATGTGAACATAGAAAATGG + Intronic
1158357456 18:56637566-56637588 GTAAATATCAACAAAATTATAGG - Intronic
1159633387 18:70776239-70776261 TTAAATGTCAGCAAAATGAAAGG + Intergenic
1159958478 18:74537087-74537109 GAAACTATCAACAGAGTAAACGG - Intronic
1159999824 18:75006315-75006337 ATAAGAGTAAACAAAGTAAAAGG - Intronic
1166271646 19:41718079-41718101 GTGAATGTCATCAGAGCAAAGGG - Intronic
1166579965 19:43887549-43887571 ATAAATGTCAACAGAATTAAAGG + Intronic
925052118 2:823969-823991 GTCAATGTCCACAAAAGAAAAGG - Intergenic
925480631 2:4267680-4267702 ATTAATATAAACAAAGTAAAAGG + Intergenic
925584949 2:5456236-5456258 GTAAATGCCAATAAACCAAAAGG + Intergenic
926253946 2:11173808-11173830 CTAAATGTTTACTAAGTAAAGGG + Intronic
926566823 2:14484927-14484949 GAAATTATCAACAGAGTAAACGG + Intergenic
926857163 2:17269735-17269757 CTAAATGCAAAGAAAGTAAAGGG - Intergenic
928056344 2:28059149-28059171 TTAAATGTCAATCAAGTCAAGGG - Intronic
930134878 2:47892070-47892092 GAAACAGTCAACAAAGTGAAAGG - Intronic
930161753 2:48165902-48165924 TTTAATGTCATCTAAGTAAAGGG - Intergenic
930992290 2:57671779-57671801 AAAAATGTCAACAAACTAGAGGG - Intergenic
931143747 2:59492475-59492497 GTAAATGACATCAGAGCAAATGG + Intergenic
931206849 2:60155710-60155732 TTAAATGAAAACAAAGGAAAAGG - Intergenic
931454287 2:62395642-62395664 GAAACTGTCAGCAGAGTAAACGG + Intergenic
931958596 2:67456584-67456606 CCAAATGTCATCAAAGCAAATGG + Intergenic
932852924 2:75204130-75204152 GAAATTATCAACAAAGCAAATGG - Intergenic
933040145 2:77454648-77454670 GTAAATGTCACAGAAATAAAAGG + Intronic
933337117 2:80973002-80973024 GAAACTGTTAACAGAGTAAACGG + Intergenic
936823299 2:116550936-116550958 GTAAAAGTCAAAAATGTAAAAGG - Intergenic
937106879 2:119324083-119324105 ATAAATGTCAATACATTAAATGG - Intronic
937124608 2:119465595-119465617 GTAAATGTTGAAAAAATAAAGGG + Intronic
937827196 2:126379937-126379959 GTACATGGTAACAAAGAAAAGGG + Intergenic
939131020 2:138236354-138236376 GAAAATGAGAACCAAGTAAAAGG - Intergenic
939995971 2:148920334-148920356 CTAAATGTCAGTAAGGTAAAAGG - Intronic
940152814 2:150621578-150621600 GGAAATGCCAACAAATGAAAGGG - Intergenic
940233674 2:151486055-151486077 GCAAGCATCAACAAAGTAAAAGG + Intronic
940456736 2:153911250-153911272 GGAAATGTCTACCAAGCAAATGG - Intronic
940961637 2:159793490-159793512 CTAAATGTTAACAAAGGAAAAGG + Intronic
941105986 2:161353727-161353749 GAAAATGTTTACAAAGTAGAAGG - Intronic
941113439 2:161444180-161444202 GTAAATATGAACAAAACAAATGG + Intronic
942522623 2:176820015-176820037 GCAAATTTCAGCAAAGTCAAGGG - Intergenic
943030108 2:182675905-182675927 GAAATTATCAACAGAGTAAATGG - Intergenic
943390012 2:187254152-187254174 GTAAAAGTTAATAAAGTATATGG - Intergenic
943606724 2:189985078-189985100 CAGATTGTCAACAAAGTAAAAGG + Intronic
943745920 2:191462823-191462845 TTAAATGTGAACTAAGGAAAAGG - Intergenic
944056665 2:195529281-195529303 GTGAATTTCAAGACAGTAAAGGG - Intergenic
944369741 2:198968073-198968095 GAAAATGTCAAAACAGTCAAGGG - Intergenic
944411937 2:199455032-199455054 GTAAAAGACAACTAAGCAAATGG + Intronic
944668755 2:201977960-201977982 GAGAATGTCAAAAAGGTAAAGGG - Intergenic
944962891 2:204896241-204896263 TTAGATGTCAGCAAAGTAAGGGG + Intronic
945263896 2:207871122-207871144 ATAAATATCACCAAAGTATATGG + Intronic
945297304 2:208183452-208183474 CTAAATTTTAACATAGTAAAAGG + Intronic
945336102 2:208594525-208594547 ATAAATGTGTACAAAATAAAAGG - Intronic
946121016 2:217514881-217514903 GTAAATGTTATTAAAGGAAAAGG + Intronic
946683878 2:222246886-222246908 GTAAATATGAACAAATCAAAAGG - Intronic
947126712 2:226876272-226876294 GTCTATGTCAACAGTGTAAATGG - Intronic
947343707 2:229168476-229168498 AACAATGACAACAAAGTAAAAGG - Intronic
947673916 2:231960933-231960955 GTAGATGTGAGCAAAGGAAAAGG - Intergenic
1169503734 20:6186055-6186077 GTAAAAGTTAACAACTTAAAAGG - Intergenic
1169817460 20:9672791-9672813 GTATATGTGGGCAAAGTAAAAGG - Intronic
1169983559 20:11415473-11415495 GTAATTTTCAAAAAAATAAAAGG - Intergenic
1170262497 20:14425911-14425933 GAAACCATCAACAAAGTAAAAGG - Intronic
1171726689 20:28628483-28628505 GTTAATATCAACAAAGCTAAGGG + Intergenic
1171751582 20:29056128-29056150 GTTAATATCAGCAAAGCAAAGGG - Intergenic
1171790758 20:29521748-29521770 GTTAATATCAACAAAGCTAAGGG + Intergenic
1171856950 20:30355090-30355112 GTTAATATCAACAAAGATAAGGG - Intergenic
1172363577 20:34332138-34332160 GTAAATGTAAACTAGGTGAAGGG - Intergenic
1172809695 20:37638484-37638506 TCAAATGTCTACATAGTAAAGGG - Intergenic
1172923153 20:38504616-38504638 GAAACTATCAACAGAGTAAATGG + Intronic
1173288964 20:41697658-41697680 GTAAAAGTAAACAATGAAAATGG - Intergenic
1173574357 20:44101458-44101480 GATATTGTCAACAGAGTAAATGG + Intergenic
1174082724 20:47982625-47982647 CTAAAAGTCAAAAAAGAAAATGG + Intergenic
1174311959 20:49663516-49663538 GTAAATGTCCAAAATATAAAAGG - Intronic
1174534377 20:51239408-51239430 GTACATTTTAACAAATTAAAAGG + Intergenic
1174772786 20:53316881-53316903 GTAAAAGTCATCACAATAAATGG + Intronic
1174934211 20:54849867-54849889 AAAAATGTCAACAAAGCATAAGG - Intergenic
1176966265 21:15215912-15215934 GAAAATGCCAACAATGAAAACGG + Intergenic
1177250959 21:18590369-18590391 GTAAATGGCATGAAAGTAATGGG - Intergenic
1177497289 21:21906158-21906180 GTAAAGAACAACAAAGTCAAGGG + Intergenic
1177739950 21:25142129-25142151 TAAAATGAAAACAAAGTAAAAGG - Intergenic
1178089144 21:29143282-29143304 GGAAATGTCAACAAATTCAGTGG + Intronic
1178605483 21:34033037-34033059 GTAAATAACAACAAACAAAACGG - Intergenic
1179261415 21:39761442-39761464 GAAATTGCCAACAGAGTAAATGG + Intronic
1179361417 21:40712973-40712995 GTAGATGTCTCCAAAGTAGATGG + Intronic
1180071584 21:45439416-45439438 GTAAAGGCCTAGAAAGTAAAAGG - Intronic
1181845547 22:25705994-25706016 ATAAATGTCAAATAAATAAAGGG - Intronic
1184353142 22:43958224-43958246 GTAAATGGCACCAAAGGAAATGG - Intronic
949390561 3:3557842-3557864 GAAAATCTTAACAAAGAAAAGGG - Intergenic
949745810 3:7290979-7291001 GTAAATGGCCACAAAGAAACTGG - Intronic
950608107 3:14102565-14102587 GAAACTATCAACAGAGTAAATGG + Intergenic
950845332 3:16010131-16010153 GTAACTATCAACAGAGTAAATGG + Intergenic
950982302 3:17320037-17320059 CTAAATGTCCCCAAAATAAAAGG - Intronic
951059764 3:18191638-18191660 GTATATGTAAGCCAAGTAAAAGG + Intronic
951127864 3:19005137-19005159 GAAACTGTAATCAAAGTAAACGG + Intergenic
951296842 3:20947560-20947582 GAAACTATCAACAGAGTAAACGG - Intergenic
952639211 3:35571415-35571437 GTAAATGAGAACAAATGAAAAGG + Intergenic
953071471 3:39525066-39525088 AAAAATGACAACAAAGTAAAAGG + Intronic
953155712 3:40370921-40370943 GAAACTATCAACAGAGTAAATGG + Intergenic
953764027 3:45719970-45719992 GTAAATGTTTACAAAGTTGAAGG - Intronic
957550358 3:81696369-81696391 GAAATTATCAACAAATTAAATGG + Intronic
957990730 3:87624204-87624226 GTAAGAGTCAACAAAATATAAGG + Intergenic
957992157 3:87639957-87639979 GAAACTGTCAAAAGAGTAAATGG - Intergenic
958463853 3:94433620-94433642 GAAAATGTAAACCAAGAAAATGG - Intergenic
958622009 3:96574267-96574289 TTAAATGTAAACAGACTAAATGG - Intergenic
959117816 3:102198108-102198130 AAAAATGTCACCAAAGGAAAGGG - Intronic
959390586 3:105768492-105768514 CTAAATGTCTACAATGTATATGG + Intronic
959533610 3:107461319-107461341 GGAAGTGTCAACAAAGCATATGG + Intergenic
959686714 3:109155424-109155446 GTCAATCTGAAGAAAGTAAATGG - Intergenic
959754237 3:109877634-109877656 GAAACTATCAACAGAGTAAATGG + Intergenic
960422903 3:117470036-117470058 GAAAAAGTCAAAAAAGGAAAAGG - Intergenic
962007855 3:131365527-131365549 GAAACAGTCAACACAGTAAAGGG - Intergenic
963337032 3:143986964-143986986 GTAAATGTCAACCTAATATATGG - Intronic
963722280 3:148876114-148876136 CTAAGTGTAATCAAAGTAAATGG + Intronic
964303425 3:155314737-155314759 GTAAATGTCTACCCAGTACAAGG + Intergenic
966235339 3:177695354-177695376 ATAAATTTCCACAAAGTATATGG - Intergenic
966534292 3:181014698-181014720 GCAAATGTCATCAGAGTAACAGG + Intergenic
969549871 4:7858125-7858147 GTAGAGGTTAATAAAGTAAATGG - Intronic
970841711 4:20479674-20479696 GTTAATTTCAACCAAGTAGAAGG + Intronic
971567432 4:28163250-28163272 ATAAAAATCAACAAAGTGAAGGG - Intergenic
971645522 4:29196170-29196192 GAAAAAATCAACAAAATAAAAGG - Intergenic
971656777 4:29357413-29357435 GAAAATTTCAACAAAATGAAGGG - Intergenic
971686099 4:29770628-29770650 GTAAAGCTCAGAAAAGTAAAAGG - Intergenic
972046266 4:34668194-34668216 TTACATGTCAGGAAAGTAAAGGG + Intergenic
972188359 4:36560266-36560288 GAAACTGTAAACAGAGTAAAGGG + Intergenic
972878796 4:43397943-43397965 TTAAATTTCAACTAAGGAAAAGG - Intergenic
973025913 4:45270727-45270749 GTATATGCCAACAAATTGAAAGG + Intergenic
974297211 4:60016339-60016361 ATAAATGTCACCAAACAAAATGG + Intergenic
974900179 4:67987310-67987332 ATAAATGTAAATAATGTAAACGG + Intergenic
975050767 4:69861958-69861980 GTCAATGTCAAAAAAAAAAATGG + Intergenic
975276165 4:72504473-72504495 TTAAATGTAACCAGAGTAAAAGG - Intronic
975321818 4:73017403-73017425 ATAAATGTATACACAGTAAATGG + Intergenic
975445651 4:74462114-74462136 GTAAATGTAAAAAAAAAAAAAGG + Intergenic
976517039 4:85980820-85980842 GCAAATGTCAACACAGTGAAAGG - Intronic
976882950 4:89951868-89951890 GTAAGTTTCGAAAAAGTAAAAGG - Intronic
977012058 4:91648571-91648593 GGAGATGTCAAGAAAGTAGATGG + Intergenic
977356155 4:95949673-95949695 GGAAGTGTGAAAAAAGTAAAAGG - Intergenic
977358243 4:95973165-95973187 GTAAATTTGAAGAAAGCAAAAGG - Intergenic
977434295 4:96973368-96973390 AAAAATGTCAATAAAGTATAAGG - Intergenic
977983580 4:103355949-103355971 TAAAAAGTCAACAAAATAAAAGG + Intergenic
978615874 4:110594870-110594892 GTAGATCTCAACAAAATATATGG - Intergenic
979400277 4:120240621-120240643 GTAAATGTTAGCAAAATAAATGG - Intergenic
979436305 4:120696309-120696331 GTAAATTTGAACAGAGTAAAGGG - Intronic
979984743 4:127299848-127299870 GAAACTGTCAACAAAGTAAATGG + Intergenic
980097095 4:128502269-128502291 TTAAATGTTAAATAAGTAAAAGG - Intergenic
980199232 4:129633298-129633320 AGCAATGTCAACAAAGGAAAAGG + Intergenic
980794343 4:137661754-137661776 TTAACTGTCAACAAACTCAAAGG + Intergenic
981087330 4:140697788-140697810 GTCAATGACAACAAAGGTAATGG + Intronic
981605958 4:146540696-146540718 AAAACTATCAACAAAGTAAATGG - Intergenic
981826348 4:148946279-148946301 GTAAATCTGAAAAAAGAAAAAGG + Intergenic
982441217 4:155438473-155438495 TTAAATGCCCACAAAGAAAATGG - Intergenic
982533156 4:156572944-156572966 GTAAAAATCAATAAAATAAAAGG + Intergenic
984764918 4:183393062-183393084 GTAAATGTAAAAAAAAAAAAAGG + Intergenic
985091652 4:186369303-186369325 GTAAATGTCAATAAACTTAAAGG + Intergenic
985296372 4:188441341-188441363 GTAAATCTCAACAATTAAAAAGG - Intergenic
985396356 4:189548789-189548811 GTAAATATGAACAAATTAAAGGG + Intergenic
985433964 4:189910455-189910477 GTTAATATCAACAAAGCTAAGGG - Intergenic
985990248 5:3551556-3551578 GAAACTATCAACACAGTAAACGG + Intergenic
986033221 5:3912630-3912652 GTTAATTTCTACAAAATAAAAGG - Intergenic
986862590 5:11944897-11944919 TTAAATGTCAACAAAGGCATAGG - Intergenic
988322808 5:29721997-29722019 ATAAATGACAACAAAGATAAAGG + Intergenic
988966843 5:36427411-36427433 GTTTTTGTGAACAAAGTAAATGG + Intergenic
992708530 5:79424304-79424326 TTAAATCTCAACTAAATAAAGGG + Intronic
992849875 5:80796333-80796355 TTAAATCTTTACAAAGTAAATGG + Intronic
992879552 5:81093114-81093136 TTAAATGACAACGAATTAAATGG - Intronic
993791273 5:92214572-92214594 GAAACTATCAACAGAGTAAATGG - Intergenic
994675244 5:102813172-102813194 ATAATTTTTAACAAAGTAAAGGG - Intronic
994704881 5:103191223-103191245 GTAGAAGTCAACAAAATATAGGG + Intronic
995321682 5:110841368-110841390 CTAAATGGCAACAAAGCATATGG - Intergenic
995406704 5:111805936-111805958 AAAAATGTAAACAAAGTAATGGG + Intronic
995448595 5:112274727-112274749 GTACATGTCAACAACTGAAAGGG - Intronic
995626655 5:114086146-114086168 TTAAATGTAAACATAGCAAAAGG - Intergenic
995821418 5:116237892-116237914 TTAAATGACAACAAAGCTAAAGG + Intronic
1000125934 5:158244066-158244088 GTAAATGACAAAGAAGAAAAAGG - Intergenic
1000430198 5:161142617-161142639 TTAAATGTAAACAAGCTAAATGG + Intergenic
1000577912 5:162998248-162998270 GAAATTGTCTACAAAGTAAGTGG + Intergenic
1000934049 5:167286808-167286830 GTAAATATTAATAAAGGAAAAGG - Intronic
1001206394 5:169767341-169767363 GCAACTATCAACAGAGTAAATGG - Intronic
1001913679 5:175541789-175541811 GTAAATGTTAGCCAAGCAAAGGG - Intergenic
1004242694 6:13940462-13940484 GTAAATATCAAAAATGAAAAGGG - Intronic
1004704285 6:18109338-18109360 GTAATTGTCAACAAATTAAATGG + Intergenic
1004846155 6:19644684-19644706 TTAAATGTCAACAGAGTATGTGG - Intergenic
1005102133 6:22182886-22182908 GAAACTATCAACAGAGTAAACGG - Intergenic
1007131521 6:39479053-39479075 GGAACAGTCAACAGAGTAAACGG - Intronic
1008035896 6:46744881-46744903 GTAGCTGTCAACCATGTAAAAGG - Intergenic
1008265639 6:49422574-49422596 GTGCATGTCGACAAAGTAAATGG + Intergenic
1008617328 6:53239392-53239414 TTCTATGTCTACAAAGTAAAAGG + Intergenic
1008771640 6:54985982-54986004 GAAAGTATCAACAGAGTAAATGG + Intergenic
1008810815 6:55496210-55496232 AGAAATGTCAAAAAAGAAAAAGG + Intronic
1009584186 6:65575468-65575490 ATAAATGTCTACAAAGAAAAAGG + Intronic
1009885976 6:69624567-69624589 GTAAATGTTGAGAAAATAAAGGG + Intergenic
1010318383 6:74477008-74477030 GAAAATGTTAACCAAATAAAAGG + Intergenic
1010494355 6:76514645-76514667 GGAAATGTCAACAAATAAAATGG + Intergenic
1011002803 6:82609793-82609815 ATTAATGTCAACAAAGGAGAAGG - Intergenic
1011861382 6:91761494-91761516 ATAAAAGTCAAGAAAGGAAATGG - Intergenic
1011880697 6:92021433-92021455 GTAAATGTTAACATAGTCAAGGG + Intergenic
1012104793 6:95143302-95143324 GTAACTATCAAAAAAGTAACTGG - Intergenic
1014201303 6:118612092-118612114 ACAAATGTCAACAAATTTAAAGG + Intronic
1014334899 6:120121083-120121105 GAAACTATCAACAGAGTAAACGG - Intergenic
1014410205 6:121106628-121106650 GCTAATATCAACATAGTAAAGGG - Intronic
1014775084 6:125499424-125499446 ATGAATCTCAGCAAAGTAAATGG - Intergenic
1014819303 6:125968963-125968985 GAAACTATCAACAGAGTAAATGG - Intronic
1015229710 6:130900636-130900658 GTAAATGTCAAATAAGTATGTGG + Intronic
1015316089 6:131818180-131818202 GTAAAAGTCAACACAGTGAAAGG - Intronic
1015482719 6:133730954-133730976 GTAAATGTCACTAAATTTAATGG - Intergenic
1016821605 6:148351722-148351744 ATTAAAGTCAACAAAGTCAAGGG - Intronic
1020414197 7:7927426-7927448 GTAAGTGGCTACAAAGAAAAAGG - Intronic
1020491647 7:8792522-8792544 GTAAATCTAAAGAAATTAAAAGG + Intergenic
1020579967 7:9984770-9984792 GTTAATGTCAAAAATGTAAAAGG - Intergenic
1020716257 7:11677426-11677448 TTAAATGTAAACAGACTAAATGG + Intronic
1020927421 7:14348933-14348955 GAACATGTAAACAAAGTTAATGG + Intronic
1021418996 7:20423659-20423681 GTTAATGTCATCAAAGGACAAGG - Intergenic
1022683201 7:32569976-32569998 GAAAATATCAGAAAAGTAAAAGG - Intronic
1024067419 7:45752274-45752296 GTAAAAGTAAAAGAAGTAAAAGG - Intergenic
1024668459 7:51568135-51568157 GATAATATCAACAGAGTAAAAGG + Intergenic
1024853709 7:53752138-53752160 ATATATGTCAACTAAATAAATGG - Intergenic
1027484000 7:78736647-78736669 GCAAATATCAACATAGAAAAGGG - Intronic
1027611405 7:80365891-80365913 GAAACTGTCAACAGAGTAAATGG + Intergenic
1028171125 7:87597962-87597984 GTCAATGTTAAAAAAATAAAAGG - Intronic
1028236006 7:88362171-88362193 GTAATTGTCAACAACCTAAGGGG + Intergenic
1028665643 7:93340875-93340897 GTCAATGTGAACAAAGGAAAGGG - Intronic
1030321894 7:108178289-108178311 GTAAATGACAAGAGAGAAAAAGG - Intronic
1030885371 7:114929997-114930019 CTAGATCTCAGCAAAGTAAATGG + Intronic
1031608520 7:123797448-123797470 AAAAATGTCAGCTAAGTAAATGG + Intergenic
1031968987 7:128049936-128049958 GTAAACGCCCACAAAGGAAAGGG + Intronic
1032273277 7:130431357-130431379 GTAAATGTCCACCAAATGAATGG - Intronic
1032921558 7:136554552-136554574 GAAAATGTCAACAAGGTTCAAGG - Intergenic
1032963476 7:137068016-137068038 GTAAATGTCATGAAAACAAAAGG - Intergenic
1033920037 7:146379429-146379451 GTTAATCTTAAGAAAGTAAAGGG + Intronic
1034184678 7:149166061-149166083 GAAAATGTAAAAAAAATAAAAGG + Intronic
1034455054 7:151165574-151165596 GAAAATGTCCACAAGATAAAAGG - Intronic
1034757698 7:153638902-153638924 ACAAATTTCAACAAGGTAAAGGG + Intergenic
1034774358 7:153811272-153811294 GTAAAAGTCAACCTAGTAAGAGG - Intergenic
1035246491 7:157565718-157565740 GTCACTGACAAAAAAGTAAAAGG + Intronic
1037078200 8:14748698-14748720 AGAAATGTGAACAAATTAAATGG + Intronic
1037421341 8:18706432-18706454 GGATAGGTCAACAAACTAAAAGG + Intronic
1037484611 8:19335503-19335525 GTAAAGTGCAACATAGTAAATGG + Intronic
1038814035 8:30882592-30882614 ATACATGTCAACATAGTTAAAGG - Intronic
1039318667 8:36402877-36402899 ATAAATGTCATCAAAGAAACAGG + Intergenic
1039759670 8:40560979-40561001 GTAAATCTCTACTAAGTAAAAGG - Intronic
1039926321 8:41935741-41935763 TTGAAAGTCAACAAAGGAAATGG + Intronic
1041412346 8:57570679-57570701 GAAAATGTCAAAAAATGAAAAGG - Intergenic
1042120211 8:65479164-65479186 GAACATGTCAACAAAATAAAGGG + Intergenic
1042619028 8:70684219-70684241 GAAAATGTTAAAAAAGTTAATGG - Intronic
1042629233 8:70798504-70798526 GAAATTGCCAACACAGTAAACGG - Intergenic
1043286819 8:78542502-78542524 GTAAACGTCAGAAATGTAAAAGG + Intronic
1043462187 8:80471440-80471462 GTGAATTTCACCAAAATAAAAGG - Intergenic
1044162782 8:88941502-88941524 GTATATGCCAACAAAGCAGATGG - Intergenic
1045149877 8:99392833-99392855 TAAAATCTCAACAAAGTAAAAGG - Intronic
1045174838 8:99711304-99711326 GTATATGGCAAGAAAGAAAAGGG + Intronic
1045542151 8:103097105-103097127 GTAAATTTTAAAAAGGTAAATGG - Intergenic
1045911792 8:107418681-107418703 GTAAATGACAAAGGAGTAAAAGG + Intronic
1045982402 8:108206120-108206142 GTAAATGTCAACAAAGTAAAAGG - Intronic
1046152418 8:110245069-110245091 GAAACTATCAACAAAGTAAACGG - Intergenic
1048858386 8:138703637-138703659 GTAAATGGTAATAAAGTGAAGGG + Intronic
1049109072 8:140631835-140631857 GAAAACGTCCACAAAGAAAAGGG + Intronic
1050766847 9:9144995-9145017 ACAAATATCAGCAAAGTAAAGGG + Intronic
1050866345 9:10504890-10504912 GTTAATGTTAACAGAGGAAAGGG + Intronic
1050881863 9:10710569-10710591 GAAAATATCAGCAAAGCAAAGGG - Intergenic
1050995797 9:12215997-12216019 GTAAATACCAACAAAAAAAAGGG - Intergenic
1051305753 9:15707124-15707146 GCAAATGACAACAGAGGAAACGG - Intronic
1051629801 9:19130735-19130757 GTAAATGGCCACAGTGTAAATGG + Intronic
1052186490 9:25602761-25602783 GTAAATGTGAACAAAGATTAAGG - Intergenic
1052557724 9:30039371-30039393 GAAAATGTCAAGAAAGAAACTGG + Intergenic
1052586325 9:30432921-30432943 GAAACAATCAACAAAGTAAATGG + Intergenic
1052701773 9:31946654-31946676 GTAAAAGTCAACAAAACAGACGG - Intergenic
1052702274 9:31951349-31951371 AAAACTGTCAACAGAGTAAATGG + Intergenic
1052814885 9:33094489-33094511 GTAAAAGCCAAGACAGTAAATGG + Intergenic
1052886469 9:33653445-33653467 GAAACTATCAACAGAGTAAATGG - Intergenic
1052895887 9:33748143-33748165 GTAAATATTAAAAAAGAAAATGG + Intergenic
1053723051 9:40968620-40968642 GTTAATATCAACAAAGCTAAGGG - Intergenic
1054342916 9:63883376-63883398 GTTAATATCAACAAAGCTAAGGG + Intergenic
1054979034 9:71182487-71182509 GTAAATATCAAAGAAGAAAATGG + Intronic
1055062876 9:72088977-72088999 GTAAATATCAACAATGCCAAAGG - Intergenic
1055713189 9:79088124-79088146 GAAAATGAGAACCAAGTAAAAGG + Intergenic
1055740070 9:79378348-79378370 GTAAGTGTCATGAAAGAAAAAGG + Intergenic
1058039140 9:100284881-100284903 GTAAAAGTGGACAAAGTGAATGG - Intronic
1058508264 9:105688702-105688724 TTAAATGACAACAAAGCAATGGG + Intergenic
1058532622 9:105921769-105921791 GCAAATGTCAAAATAGTGAAAGG + Intergenic
1059222013 9:112631570-112631592 ATAAATCTTAACAAAGCAAATGG - Intronic
1059316429 9:113429551-113429573 GTAGAGGTGAACAAAGAAAATGG - Exonic
1059415149 9:114157573-114157595 GAAAATGCCAACAAAGAACAGGG - Intronic
1059799400 9:117734934-117734956 AAAAATGTCAGCAAAGAAAAGGG - Intergenic
1060102061 9:120849368-120849390 GCAAATGTCAACATAGTAAAAGG + Intergenic
1060319644 9:122545207-122545229 ATAAATGTTAATAAATTAAAAGG - Intergenic
1060340642 9:122773202-122773224 GAAACTATCAACAGAGTAAATGG + Intergenic
1060437998 9:123612121-123612143 GTAAATGATGACAATGTAAAAGG - Intronic
1060451115 9:123741379-123741401 ATCAATGTCAACAATGTCAAAGG + Intronic
1202804003 9_KI270720v1_random:33194-33216 ATCACTGTCAACAGAGTAAAAGG + Intergenic
1203697455 Un_GL000214v1:112422-112444 GGAACTGTCAGCAGAGTAAATGG + Intergenic
1203452094 Un_GL000219v1:127362-127384 GTTAATATCAACAAAGCTAAGGG + Intergenic
1186372714 X:8964077-8964099 GAAACTATCAACAGAGTAAAGGG + Intergenic
1187022378 X:15397410-15397432 GTACATGTTAAGAAAGTTAAAGG + Intronic
1187292438 X:17968113-17968135 TTAAATGTAAACAAAGGAATAGG + Intergenic
1188084436 X:25885506-25885528 GAAAAGGTCAACAAAATAGATGG + Intergenic
1189061329 X:37756369-37756391 GTAAAAGACAAGAAAATAAATGG + Intronic
1189639531 X:43052870-43052892 GAAAAAGTCAACAGAGTGAAGGG - Intergenic
1189764399 X:44355382-44355404 GAAATCATCAACAAAGTAAAAGG + Intergenic
1189880269 X:45483920-45483942 GAAACTATCAACAAAGTAAAAGG - Intergenic
1190904000 X:54708123-54708145 GTAAATGTCAGCAAATTAGCGGG - Intergenic
1192418301 X:71004580-71004602 CTAAATTTCAAAAAAGCAAATGG - Intergenic
1192595260 X:72400347-72400369 GGAAATGTCAAGTAAGTAGAAGG - Intronic
1192942213 X:75924720-75924742 GAAACTATCAACAAAGTAAAGGG + Intergenic
1193065871 X:77259321-77259343 GAAAATATTAACAAAATAAATGG + Intergenic
1193155430 X:78167521-78167543 GTATATGTCAAAAAAGCAAACGG - Intergenic
1193674397 X:84431714-84431736 CTAAATGTCAAGAAACTATAAGG - Intronic
1194081413 X:89470227-89470249 ATAAATGTGAACAAATGAAAAGG - Intergenic
1194148789 X:90297464-90297486 ATAAATGCCAACAAACAAAAGGG + Intergenic
1194424075 X:93715615-93715637 ATAAATATCAACAAAAAAAATGG + Intergenic
1194506008 X:94734275-94734297 GGAAATGTTAACAGAATAAAAGG - Intergenic
1194551548 X:95307214-95307236 GTAAATAAGAACAAAGAAAAAGG + Intergenic
1194622802 X:96194260-96194282 GTAAAAGTTAATAATGTAAAAGG - Intergenic
1196187820 X:112763347-112763369 ATAAATGCAAACAAAGTAATTGG - Intergenic
1196479656 X:116132524-116132546 GAAATGATCAACAAAGTAAAGGG - Intergenic
1196540645 X:116902988-116903010 GAAATTATCAACAGAGTAAACGG + Intergenic
1197377529 X:125699763-125699785 GAAACTATCAACAAAGTAAATGG + Intergenic
1197436016 X:126429337-126429359 GAAAATGTCAATAAAGTCATAGG - Intergenic
1198296020 X:135287470-135287492 ATAAATGTCAACAATGTGACAGG - Exonic
1198663776 X:138999408-138999430 GAAAAGATCAACAAAATAAATGG + Intronic
1198773959 X:140159790-140159812 GCAAATGTCAACACAGTGAAAGG - Intergenic
1198839682 X:140843066-140843088 TTAAATGTCAGCAAATTAAGGGG + Intergenic
1198989559 X:142496155-142496177 GCAAATGTCACCAAAGTTAAAGG - Intergenic
1199613793 X:149639572-149639594 GTTGATGTCAACAAAGGGAAGGG + Intergenic
1200425392 Y:3014799-3014821 GAAAACGTCAACAAACTAATAGG - Intergenic
1200434087 Y:3126413-3126435 ATAAATGTGAACAAATGAAAAGG - Intergenic
1200495158 Y:3874196-3874218 ATAAATGCCAACAAACAAAAGGG + Intergenic
1200942168 Y:8795740-8795762 GTCAATGTCAGAAAAATAAAGGG + Intergenic