ID: 1045982404

View in Genome Browser
Species Human (GRCh38)
Location 8:108206154-108206176
Sequence CCAACCGTGTTAGATGCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045982398_1045982404 30 Left 1045982398 8:108206101-108206123 CCAGCCAAACCAAACCAATCCTT 0: 1
1: 0
2: 1
3: 21
4: 213
Right 1045982404 8:108206154-108206176 CCAACCGTGTTAGATGCTACTGG No data
1045982400_1045982404 21 Left 1045982400 8:108206110-108206132 CCAAACCAATCCTTTTACTTTGT 0: 1
1: 0
2: 3
3: 29
4: 453
Right 1045982404 8:108206154-108206176 CCAACCGTGTTAGATGCTACTGG No data
1045982402_1045982404 11 Left 1045982402 8:108206120-108206142 CCTTTTACTTTGTTGACATTTAC 0: 1
1: 0
2: 5
3: 40
4: 459
Right 1045982404 8:108206154-108206176 CCAACCGTGTTAGATGCTACTGG No data
1045982401_1045982404 16 Left 1045982401 8:108206115-108206137 CCAATCCTTTTACTTTGTTGACA 0: 1
1: 0
2: 1
3: 23
4: 308
Right 1045982404 8:108206154-108206176 CCAACCGTGTTAGATGCTACTGG No data
1045982399_1045982404 26 Left 1045982399 8:108206105-108206127 CCAAACCAAACCAATCCTTTTAC 0: 1
1: 0
2: 2
3: 33
4: 242
Right 1045982404 8:108206154-108206176 CCAACCGTGTTAGATGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045982404 Original CRISPR CCAACCGTGTTAGATGCTAC TGG Intronic
No off target data available for this crispr