ID: 1045989562

View in Genome Browser
Species Human (GRCh38)
Location 8:108289791-108289813
Sequence TCATGCTGGAATGCAGCTAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045989562 Original CRISPR TCATGCTGGAATGCAGCTAA CGG (reversed) Intronic
901118357 1:6867847-6867869 CCAGGCTGGAATGCAGCGAGTGG + Intronic
902107855 1:14052682-14052704 TCATCCTGGAGAGCAGCAAAAGG + Intergenic
905222626 1:36459355-36459377 TCAGGCTGGAATGCAGTCAGTGG - Intronic
908636657 1:66174121-66174143 TCCTGCTGAACTACAGCTAATGG + Intronic
909351471 1:74658314-74658336 ACATGCTGAAATGCAGCTTTGGG + Intronic
917706970 1:177644804-177644826 GCATTTTGGAATGCAGCTAAGGG - Intergenic
918585479 1:186183257-186183279 ACTTGCTGCAATGCAGCTTATGG + Intronic
919578126 1:199337162-199337184 TCAGGCTGGTGTGCAGCTATAGG - Intergenic
920736245 1:208535493-208535515 TCATGCAGAAATGAAGCTCAAGG - Intergenic
921985116 1:221304545-221304567 TCAGGATGGAATGCACTTAATGG - Intergenic
923820839 1:237439142-237439164 TCATGCTGTACTTCAGCTTACGG + Intronic
924663019 1:246039780-246039802 TCATGCTGTAATGGAGCCAAGGG + Intronic
1063648415 10:7908959-7908981 TGATGCTGCTATGCTGCTAAGGG + Intronic
1063999761 10:11653793-11653815 TCATTTTGGATTCCAGCTAAGGG + Intergenic
1064178369 10:13095069-13095091 TCATGCTGGATTTCAGGGAAAGG + Intronic
1066998946 10:42588220-42588242 TCATGCAGGGATACAGCCAATGG + Intronic
1071810286 10:89172472-89172494 TGCTGATGAAATGCAGCTAATGG + Intergenic
1073286630 10:102393772-102393794 TCAGGCTGGAATGCAGTGAGGGG - Intergenic
1075779756 10:125009547-125009569 TCATGCTGGATTGCAGAAAGCGG - Intronic
1079001703 11:16763014-16763036 CCAGGCTGGAATGCAGTGAATGG - Intergenic
1080729753 11:34937328-34937350 TGGTGCTGGAATGCAGAGAAAGG + Intronic
1082190927 11:49243806-49243828 TCATTCTGGAATGCGGCAAGAGG - Intergenic
1084534525 11:69748808-69748830 CCATGCTGGGGTGCAGCTGACGG - Intergenic
1090454306 11:126834720-126834742 TCATGCTGGACTGCATAGAATGG + Intronic
1093121608 12:15277620-15277642 TCTTGGTGGAATGCAGCATAGGG - Intronic
1096829231 12:54301359-54301381 TCAAGGTGGAAGGCAGCTGAAGG + Intronic
1103852948 12:123945264-123945286 TCCTGCCGGAATGCTGCTCACGG - Intronic
1105060426 12:133145356-133145378 ACATGCTGGACTGCAGCAGATGG + Intronic
1106502301 13:30340558-30340580 CCCTTCTGGAATGGAGCTAAGGG + Intergenic
1108601392 13:51998140-51998162 TGATGCTGGAATTCAGATAAGGG - Intronic
1108646007 13:52429201-52429223 TCATGCTGTAAGTCAGCTTAAGG - Intronic
1111414321 13:87918667-87918689 TCATGCTTTAGTGCAGCTAAGGG - Intergenic
1112585428 13:100715150-100715172 TCTGGCTGGGATGCAGCTATTGG - Intergenic
1114656864 14:24321379-24321401 TCAGGCTGGAGTGCATGTAATGG - Intronic
1115784342 14:36807289-36807311 CCAAGCTGGAATGCAGTGAATGG - Intronic
1116051398 14:39807800-39807822 CCAGGCTGGAGTGCAGATAAAGG + Intergenic
1116248164 14:42444851-42444873 TCAGGCTGGAGCGCAGTTAATGG - Intergenic
1116605704 14:46991656-46991678 TCATACTGGAATGTTTCTAAGGG + Intronic
1118441107 14:65812499-65812521 TCAAGCTGGAATGCAGTGATGGG + Intergenic
1118505429 14:66405661-66405683 TCATCCTAGAATCTAGCTAAAGG - Intergenic
1122615468 14:103014811-103014833 CCAGGCTGGAGTGCAGCTCAAGG - Intronic
1126771232 15:52058079-52058101 CCATGCTGGAGTACAGCAAATGG + Intronic
1129834603 15:78694204-78694226 TCATGCAGGCATGCAGCTCCTGG - Intronic
1130748889 15:86688126-86688148 TCATGTATGAATGCAGCTAAAGG + Intronic
1131399369 15:92112260-92112282 TCATGCTGGAAGGCAGACTAGGG + Intronic
1133148773 16:3810713-3810735 TCAAGCTGGAGGGCAGCCAATGG - Exonic
1133646779 16:7771954-7771976 TCAAGCTGGAATTCATTTAATGG + Intergenic
1135286361 16:21196842-21196864 TCAAGATCGAATGCAGGTAATGG + Intergenic
1139944834 16:70633295-70633317 TCATGCTGGAGTGCAGTGACAGG + Intronic
1140300542 16:73753148-73753170 TCATGCCTGAATGTAGCTTATGG - Intergenic
1141998686 16:87650978-87651000 TCATGCTAGGAAGAAGCTAATGG + Intronic
1144266656 17:13575898-13575920 TCTTTCTGGAAAGCAGATAAAGG + Intronic
1144963258 17:19058892-19058914 CCAGGCTGGAATGCAGCTCTTGG - Intergenic
1144964432 17:19067161-19067183 CCAGGCTGGAATGCAGCTCTTGG + Intergenic
1144971901 17:19115633-19115655 CCAGGCTGGAATGCAGCTCTTGG + Intergenic
1144983535 17:19185013-19185035 CCAGGCTGGAATGCAGCTCTTGG - Intergenic
1144984690 17:19193226-19193248 CCAGGCTGGAATGCAGCTCTTGG + Intergenic
1145750472 17:27351851-27351873 TCCTGCTGGAATGTAATTAAAGG - Intergenic
1146695173 17:34903371-34903393 TGATGCTGTAATCCAGCTAGTGG - Intergenic
1151162311 17:72175870-72175892 TCAAGCTGGAATGGAGCAAGTGG - Intergenic
1152974833 18:205175-205197 TCATGCTAAAATACACCTAAAGG - Intronic
1156337541 18:36184732-36184754 TCTTGGTGAAATGCACCTAAGGG + Intergenic
1157550872 18:48581075-48581097 TGATGCTGGAATGACGCTGAAGG - Intronic
1159190618 18:65037029-65037051 TCAGGCTGGAGTGCAGCGACGGG + Intergenic
1162474404 19:10891396-10891418 CCTTGCTGGAATGCAGGTCAGGG + Intronic
1163310008 19:16508433-16508455 TCAGGCTGGAATGCAGTTGGGGG + Intronic
1166328439 19:42065372-42065394 TCATCCAGGATTGCAGCTGAGGG + Exonic
926408402 2:12577084-12577106 TCCTGCTGGACTGCAGCTTGAGG - Intergenic
928379287 2:30803808-30803830 TCATGTTGAAAGGCAGCTAAAGG - Intronic
931117815 2:59183522-59183544 TCATGTTTGAATGTAGCTAAGGG + Intergenic
931215407 2:60237652-60237674 TCTTGCTGGTATGTACCTAATGG + Intergenic
932369494 2:71175582-71175604 TCATGCAGGCATGCAGCTCCTGG - Intergenic
933240836 2:79918630-79918652 TCATGCTGGAATCTAGCTTCTGG - Intronic
935501376 2:103844008-103844030 TCAGGCTGGAATGCAGTGACAGG - Intergenic
935925317 2:108062158-108062180 ATATGTTGGAATGCAGCAAAAGG + Intergenic
938004137 2:127773901-127773923 GCATGGTGGCATGCACCTAATGG - Intronic
938445274 2:131371947-131371969 TCTTGTGGGAATGCGGCTAATGG + Intergenic
938973098 2:136449909-136449931 GGAGGCTGGAATGTAGCTAAAGG + Intergenic
939129377 2:138216091-138216113 TCACGCTGGAAAGTGGCTAAAGG - Intergenic
939165087 2:138632070-138632092 TCATGCCTGAATGAAGCTTATGG + Intergenic
940957834 2:159748815-159748837 TCAGGTTGGAATTCAGCTGATGG + Exonic
942687671 2:178550590-178550612 CCTTGCTTGAATGCAGCTGATGG - Intronic
943331489 2:186564811-186564833 CCATGCTGGAATGCAGTGAGTGG - Intergenic
944337774 2:198557521-198557543 TCATCCTGTAATTCAGCAAAAGG - Intronic
1172418825 20:34796747-34796769 GCATGCTGGAATGCTGATCATGG - Intronic
1172838632 20:37888664-37888686 TCCTGCTGGACTCCAGCTCAGGG - Intergenic
1173975979 20:47187006-47187028 CCATGCTGGAATGCAGATCATGG - Intronic
1179132378 21:38649650-38649672 CAATGCTTGAATGCAGCTTACGG + Intronic
1179289386 21:40005487-40005509 TCAGGCTGGAATGCAATGAATGG - Intergenic
1179305799 21:40153140-40153162 TTATGTTGGAAAGCAGGTAAGGG - Intronic
953029296 3:39167792-39167814 TCAAGTTGGACTACAGCTAATGG + Intergenic
955487032 3:59445510-59445532 TCATTCTGGACTGTAGCTGAAGG + Intergenic
956700447 3:71954393-71954415 TCATGCTGGAAGGTTGCTGAGGG - Intergenic
956872386 3:73430720-73430742 TGTGGCTGGAATCCAGCTAAGGG - Intronic
956888962 3:73590986-73591008 TCATTCAGGAATGCATATAATGG - Intronic
957303303 3:78421415-78421437 TCATGCTGAAATGCAGGGGATGG - Intergenic
957792957 3:84961973-84961995 TCATGCCTGAATGCTGCTGATGG - Intronic
959614748 3:108334782-108334804 TCATGCTGGAAGGATGCTATGGG + Intronic
961778227 3:129305496-129305518 TCAGGCTGGTTTGAAGCTAAAGG - Exonic
962101807 3:132350692-132350714 TTATGCTGGATGGCAGCTGAAGG + Intronic
965334661 3:167421521-167421543 AAATGCTGAAATCCAGCTAATGG + Intergenic
965453953 3:168874375-168874397 TCTTGCTGGAATGCTGGCAATGG + Intergenic
966493543 3:180555179-180555201 TCATGTGGGAATGCAGCAAGAGG - Intergenic
971735188 4:30439942-30439964 TTAAGCTGGGATGCAGCTTAGGG - Intergenic
972055943 4:34803864-34803886 TCACGCTGGAATGATGATAAAGG - Intergenic
973316676 4:48767823-48767845 TAATCCTGGATTGCAGCTACGGG + Intronic
974953875 4:68615130-68615152 TGATGGTGGCATGCAGCTAAGGG + Intronic
975665341 4:76729275-76729297 AGAGGCTGGAATGTAGCTAAGGG - Intronic
982562751 4:156950235-156950257 TCATCCTGGAATGGAGGGAAAGG - Intronic
986165946 5:5271491-5271513 TCATGCTAGAATGCAGATGGGGG - Intronic
986786552 5:11119786-11119808 TCAGGCTGGAAAGCAACTTAGGG + Intronic
988862486 5:35298083-35298105 TCTTGCTCACATGCAGCTAAGGG + Intergenic
988914980 5:35883201-35883223 CCATGCTGGAAAGCCACTAAGGG - Intergenic
989198034 5:38734797-38734819 ACATGCTGTAATATAGCTAATGG - Intergenic
992646928 5:78819856-78819878 TCATGCTGAAAAGGAGCCAAGGG + Intronic
996549865 5:124718854-124718876 TAATGCTGGAATGAAACAAATGG + Intronic
998467812 5:142359538-142359560 TAATGATGGACTGCAGATAACGG + Intergenic
999274361 5:150319164-150319186 TCCTCCTGGAATGCAGCTGGAGG - Intronic
1000260030 5:159578885-159578907 TAATGCTGCAATGCAGCAAAAGG + Intergenic
1001856246 5:175013186-175013208 TGAAGCTGGATTGCAGCAAATGG - Intergenic
1002067929 5:176661566-176661588 TCATGGTGGAAAGCAGCTCCGGG + Intergenic
1003187148 6:3841839-3841861 TCATCCTGGAAAGCAGCTCCAGG + Intergenic
1003614265 6:7641193-7641215 CCATGTTGCATTGCAGCTAAGGG + Intergenic
1005324901 6:24690461-24690483 TCATTCTGGAATGCCTATAAAGG - Intronic
1008455143 6:51701521-51701543 TCATACTGGAATTTAACTAATGG - Intronic
1010234365 6:73562956-73562978 CCAGGCTGGAATGCAGCTGCAGG + Intergenic
1011397924 6:86929651-86929673 TCATGCTGATATGCAGCTTGAGG + Intergenic
1014965751 6:127748084-127748106 TGATGCTGAAGTGGAGCTAATGG + Intronic
1016394468 6:143608106-143608128 TCAGCCTGTAATGGAGCTAATGG + Intronic
1016612100 6:146001500-146001522 TCATGCTGGGAAGCAACTAAGGG + Intergenic
1017019828 6:150131071-150131093 CAATGCTGGAATGCAGTTGAGGG - Intergenic
1024159611 7:46660886-46660908 TGGTGTTTGAATGCAGCTAATGG - Intergenic
1024686345 7:51750132-51750154 TCATCATTGAATGCAGCTAATGG + Intergenic
1025555627 7:62304396-62304418 TCATGATCGAATGGAGCAAATGG + Intergenic
1028574105 7:92327232-92327254 TCATGCTGCAAAGCAGATACTGG - Intronic
1029426468 7:100497466-100497488 CCAGGCTGGAATGCAGTGAAGGG - Intergenic
1029619820 7:101683238-101683260 TCATCCAGGAATCCAGCGAAAGG + Intergenic
1034408438 7:150922260-150922282 TGATCCTGGATTGCAGCTAGTGG + Intergenic
1034693438 7:153032989-153033011 TCTTGCTGAAAAGCAACTAAAGG + Intergenic
1036661285 8:10710740-10710762 TAATGGGGGAATGCAGCCAAGGG + Intronic
1041477451 8:58282123-58282145 TTATGCTGCACTGCAGCTGAGGG + Intergenic
1041732233 8:61074292-61074314 CCATGCTGGAATGCAGTGATGGG - Intronic
1042113185 8:65403511-65403533 TCATGGTATAATGCAGCAAAAGG - Intergenic
1043323877 8:79025732-79025754 TCAAGCTGGACAGCAGCTAATGG + Intergenic
1045433994 8:102141133-102141155 TCATCCTTGAATGGAGATAAAGG - Intergenic
1045989562 8:108289791-108289813 TCATGCTGGAATGCAGCTAACGG - Intronic
1050575521 9:6991118-6991140 TCATGCTGGAGTGCAGTGGAGGG + Intronic
1050904910 9:10992133-10992155 TCATGCATGAATGCAGCAAGGGG - Intergenic
1055517687 9:77049743-77049765 TCATTCAGGGATGTAGCTAAAGG + Intergenic
1055763107 9:79631277-79631299 TCATGCTTGAATGGTGCTGATGG + Intronic
1058879497 9:109274206-109274228 TCATGTTGAAAAGCAGCTTAGGG + Intronic
1059563903 9:115363526-115363548 TCAGGCTGTAATGCAGCAAGGGG + Intronic
1061252070 9:129432317-129432339 ACAGACTGGAATGCAGCTGAGGG - Intergenic
1186288385 X:8069876-8069898 TGATGCTGTAATTCAGTTAAAGG - Intergenic
1195375005 X:104218427-104218449 TCATGCTGGCAAGAAGCTTACGG + Intergenic
1197482560 X:127005050-127005072 ACATGCTGGCAAGCAGTTAAGGG - Intergenic
1197688245 X:129467539-129467561 TCATGCTGGTATGAAGGAAAAGG + Intronic
1199364887 X:146970014-146970036 TCAGGATGGAATGCAGCCATAGG - Intergenic
1199382483 X:147185756-147185778 TCAGGATGGAATGCAGCCATAGG + Intergenic
1199714754 X:150499251-150499273 TCATTCTGGAATTAAGGTAATGG - Intronic
1200822052 Y:7596191-7596213 TGTTGCTGGCCTGCAGCTAAGGG + Intergenic
1202238249 Y:22737826-22737848 TGTTGCTGGCCTGCAGCTAAGGG - Intergenic