ID: 1045989962

View in Genome Browser
Species Human (GRCh38)
Location 8:108295489-108295511
Sequence GGTTACTCCTGGGCCAATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 65}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045989962_1045989968 16 Left 1045989962 8:108295489-108295511 CCAGTATTGGCCCAGGAGTAACC 0: 1
1: 0
2: 0
3: 3
4: 65
Right 1045989968 8:108295528-108295550 TCAACGAGCTGTTACTGGCTGGG No data
1045989962_1045989967 15 Left 1045989962 8:108295489-108295511 CCAGTATTGGCCCAGGAGTAACC 0: 1
1: 0
2: 0
3: 3
4: 65
Right 1045989967 8:108295527-108295549 ATCAACGAGCTGTTACTGGCTGG No data
1045989962_1045989966 11 Left 1045989962 8:108295489-108295511 CCAGTATTGGCCCAGGAGTAACC 0: 1
1: 0
2: 0
3: 3
4: 65
Right 1045989966 8:108295523-108295545 TCTGATCAACGAGCTGTTACTGG No data
1045989962_1045989969 24 Left 1045989962 8:108295489-108295511 CCAGTATTGGCCCAGGAGTAACC 0: 1
1: 0
2: 0
3: 3
4: 65
Right 1045989969 8:108295536-108295558 CTGTTACTGGCTGGGACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045989962 Original CRISPR GGTTACTCCTGGGCCAATAC TGG (reversed) Intronic
901702742 1:11054205-11054227 AGGTACTCCAGGGCAAATACAGG - Intergenic
906112076 1:43330663-43330685 GGTTACTACTGGGCAACTACTGG + Intergenic
907322813 1:53616459-53616481 GGTAACTCCTGTGCCCACACTGG + Intronic
915313501 1:155016086-155016108 GGTATCTCCTGGGGCAATAGTGG + Intronic
916683191 1:167122480-167122502 GGTGGCTTCTGGGCAAATACAGG + Intronic
1065082907 10:22144807-22144829 GGTTCCTCCTGGGCAATTAAGGG + Intergenic
1069364733 10:67685436-67685458 GGTTCCTCCTGGGCGATTAAGGG - Intronic
1070826684 10:79394322-79394344 GGGAACTCCTGGGCCAACATGGG - Exonic
1077162961 11:1121920-1121942 GGTCACTTCTGGGCCCACACAGG - Intergenic
1078857127 11:15215402-15215424 GGCTACTCCTGGGCCCATCATGG + Intronic
1082870721 11:57942121-57942143 GGTTACTCCAGGGACAGCACTGG + Intergenic
1083869130 11:65476423-65476445 GGTTAGAGCTGGGCCAATAGTGG + Intergenic
1084028003 11:66465051-66465073 GATTTCTCCTGGGGCAGTACTGG - Intronic
1085734036 11:79023785-79023807 TCTTAGTGCTGGGCCAATACTGG + Intronic
1087153950 11:94883100-94883122 GGTGACTCCCTGGCCAATCCAGG - Intergenic
1090663685 11:128900788-128900810 GGATTCTCCTGAGCCAACACAGG + Exonic
1096902171 12:54895670-54895692 AATTACTCCTGGGAAAATACAGG - Intergenic
1098910455 12:76203618-76203640 GAGTAATGCTGGGCCAATACTGG + Intergenic
1102176171 12:110876572-110876594 GGTTTCTGCAGGGCCAACACTGG - Intronic
1106218382 13:27723126-27723148 GGTTACTCTGGGGCTGATACAGG - Intergenic
1108515824 13:51201645-51201667 GGTTCCTCCTGGGCAATTAAGGG - Intergenic
1113740971 13:112712214-112712236 GTTTACTCCTGGGGAACTACCGG - Intronic
1114434556 14:22694202-22694224 GGTTACCACTGGGCTAAAACGGG - Intergenic
1117030038 14:51659146-51659168 GGTTACACATGGGAGAATACTGG - Intronic
1118476321 14:66120821-66120843 GATTACTGCTGGGCCAAGAGGGG + Intergenic
1119958272 14:78824269-78824291 GGGTACTCCTTGGCCAATAGGGG + Intronic
1125042726 15:35210452-35210474 GTTTACTCATGGACCAATAAAGG + Intergenic
1130327898 15:82896200-82896222 GGCTACTGCTGGGCCACCACAGG - Intronic
1141192757 16:81836315-81836337 GCTGACACGTGGGCCAATACAGG - Intronic
1142370004 16:89674083-89674105 GGGTACTCCAGGGCCAACCCTGG - Intergenic
1150265392 17:63829257-63829279 TGTTACTCCTGGACCAGTATTGG + Intronic
1163649797 19:18510574-18510596 GGTGACTCCTGGGTCCATCCAGG + Intronic
1163770327 19:19187125-19187147 GGTCACTCCTGGCCCATGACAGG + Intronic
1164599186 19:29549507-29549529 GGGTTCTCCTGGGGCAGTACTGG - Intronic
1165845781 19:38816841-38816863 GATTGCTCCTGGGGCCATACTGG - Intronic
926055927 2:9773969-9773991 GGTTCCTCCTGGGGCTATAAGGG + Intergenic
927879892 2:26682878-26682900 GGTTCCTCCTGGGTGAATCCAGG + Intergenic
949047536 2:241878802-241878824 GGTTGCACCTGGGCCCACACTGG + Intergenic
1172962314 20:38807388-38807410 GAACACTCCTTGGCCAATACTGG + Intronic
1173628424 20:44491139-44491161 GGTTATTCCTGGGTCACTTCTGG + Exonic
1175009622 20:55722007-55722029 GGCTACTCCTGAGCCATTCCTGG + Intergenic
1179099246 21:38342071-38342093 GGTCACTCATGGGGCAATGCAGG - Intergenic
1179104492 21:38386667-38386689 GGTCACTCATGGGCCAAACCAGG + Intronic
951447151 3:22796060-22796082 GGTTCCTCCTGGACCAGTAAAGG + Intergenic
960854397 3:122087705-122087727 TGTTACTCCTGGGCCAGGCCAGG + Intronic
965368192 3:167825225-167825247 GTTTACTTCTGAACCAATACAGG + Exonic
971897034 4:32610081-32610103 GCTTATTCCTGGGCTAATTCTGG + Intergenic
975528721 4:75378484-75378506 GGATACTCCTGCCCAAATACTGG + Intergenic
985922258 5:2986570-2986592 GGTTGCTCCTGGGCCACCAAGGG - Intergenic
987931052 5:24399575-24399597 GGTTCCTCCTGGGCAATTAAGGG + Intergenic
991447628 5:66717151-66717173 GGATAGTCCTGGGCCCATCCTGG - Intronic
1002824662 6:761888-761910 GGTTACTCATAGGCCATTAAAGG - Intergenic
1005407967 6:25512068-25512090 TGTTAAAACTGGGCCAATACTGG - Intronic
1005490238 6:26341403-26341425 GGCTACTCCTGAGTCAATAATGG - Intergenic
1007088062 6:39164468-39164490 TGTGACTCCAGGGCCATTACAGG + Intergenic
1007726887 6:43922031-43922053 TGCTTCTCCTGGGCCAATACTGG + Intergenic
1008589690 6:52981661-52981683 TGTAACTCCTGGGCCAAACCTGG - Intronic
1015090446 6:129350464-129350486 GGTTAGTCATGGGCCACTGCAGG - Intronic
1015230333 6:130907909-130907931 GGTTTCTCCTGGGACAACTCTGG + Intronic
1017950156 6:159129350-159129372 GGTGACTGCTGGGCACATACGGG + Intergenic
1023118590 7:36886522-36886544 AGTTTCTCCTGGGCCATAACTGG + Intronic
1031342054 7:120614862-120614884 GTTTTCTCCTGGGCCAAGAATGG - Intronic
1033590616 7:142805304-142805326 GGATTCTTCTGGGCCAATTCTGG + Intergenic
1035812123 8:2501205-2501227 GGTTTCTCCTGTGTCAACACCGG + Intergenic
1042959554 8:74289000-74289022 GTTTAGTGCTGGGCCAATATGGG + Intronic
1043487248 8:80710177-80710199 GGTAACTCTTGGGCAAATATTGG - Intronic
1045989962 8:108295489-108295511 GGTTACTCCTGGGCCAATACTGG - Intronic
1049005604 8:139853664-139853686 AGTTCCTCCTGGGCCAATGATGG + Intronic
1049695933 8:143984303-143984325 GGTTTCTCCTGGGCCCAGAAGGG - Exonic