ID: 1045990932

View in Genome Browser
Species Human (GRCh38)
Location 8:108306877-108306899
Sequence GCCTCCTGGAAAATAACATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 125}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045990932_1045990934 -4 Left 1045990932 8:108306877-108306899 CCAGATGTTATTTTCCAGGAGGC 0: 1
1: 0
2: 2
3: 10
4: 125
Right 1045990934 8:108306896-108306918 AGGCAATAAAATACTCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045990932 Original CRISPR GCCTCCTGGAAAATAACATC TGG (reversed) Intronic
902092702 1:13916118-13916140 CACTCCTGGAAAACCACATCTGG - Intergenic
903972432 1:27127763-27127785 GCCTCCTGCACAATACCAGCAGG + Intronic
905556545 1:38889864-38889886 GCCTTTGGGAAAATAGCATCAGG + Intronic
905808119 1:40891630-40891652 GCCTCCTTGGAACTCACATCAGG + Intergenic
909912915 1:81282354-81282376 GCCTTCTGGAAGACAACATGAGG + Intergenic
912175746 1:107154230-107154252 GCCACTTGGAAAATACTATCTGG + Intronic
912654628 1:111475011-111475033 GCCTCCTAAAAAAAAAAATCAGG + Intronic
914939369 1:152009012-152009034 GACTCCTAGACAATAACATAGGG - Intergenic
915650007 1:157302806-157302828 GCTTCCTGGAAAAGGCCATCTGG + Intergenic
919171097 1:193955168-193955190 GCGCCCTGAAAAATATCATCTGG + Intergenic
920899588 1:210094108-210094130 GCCTCCTGCATAATAAGATTAGG - Intronic
1063559953 10:7116508-7116530 TCCTCCTGGAAACTACCATCTGG - Intergenic
1065759328 10:28967257-28967279 GTCTCCTGAAAAATGACATAAGG - Intergenic
1068313433 10:55309576-55309598 GGCTCCTGAAAAATATCATTAGG - Intronic
1069179873 10:65344778-65344800 GCCTCCTGGGAAGTAATATCTGG - Intergenic
1072829604 10:98644017-98644039 ACCTACTGAAAAATTACATCTGG - Intronic
1074820177 10:117172583-117172605 GCTTCCTGGAAAATTGCATTTGG - Intergenic
1078723797 11:13909458-13909480 GCCTCCTACAAAATAGCAGCTGG - Intergenic
1078858869 11:15228993-15229015 GGCTCCTGGAAAATACCTCCTGG - Intronic
1080880487 11:36315405-36315427 GCCTTCAGCAAAATAACATCAGG - Intronic
1083408446 11:62474867-62474889 ACCTGCTGGAAAGGAACATCTGG + Intronic
1084670060 11:70600838-70600860 AACTCCTGGAAAATAAGATTGGG + Intronic
1084855203 11:71980058-71980080 GTCTCCTAGAAAATGACACCTGG + Intronic
1088460693 11:110079768-110079790 GCCTCCTGGAAACTATATTCTGG - Intergenic
1098320407 12:69238450-69238472 GCGACCTGGCAAATAAGATCAGG + Intergenic
1103224132 12:119272283-119272305 TCATCCTGGAAAATAACAAATGG + Intergenic
1106120783 13:26858630-26858652 CCCTCCTGCATAATAGCATCCGG + Intergenic
1109693267 13:65921031-65921053 AACTCCTAGAAGATAACATCAGG + Intergenic
1114309797 14:21456307-21456329 GCCTGATTGAAAATAAAATCTGG + Intergenic
1114846580 14:26330331-26330353 GCCTCCTGGAAATTTCCATGTGG - Intergenic
1116091602 14:40314286-40314308 GCATCCTAGTAAATAATATCAGG - Intergenic
1116247129 14:42429565-42429587 GCCTCCTGGATAATATCACGGGG + Intergenic
1118742561 14:68750531-68750553 GCCTTTTGGAAAATAGCATTTGG - Intergenic
1119806158 14:77483961-77483983 GCCTCCTGGAAAAGACCTGCAGG - Intronic
1125294788 15:38191045-38191067 GGCTCCTGTATAATAACAACGGG - Intergenic
1126654242 15:50958180-50958202 GCTTACTGGAAAATAATAACAGG + Intronic
1127989209 15:64098966-64098988 GCATCCTGAAGATTAACATCAGG - Intronic
1128983231 15:72201109-72201131 GCCCCCTGGGAATCAACATCAGG + Intronic
1131596402 15:93802656-93802678 CCCTCCTGGAAATTAACCCCAGG - Intergenic
1131735598 15:95327993-95328015 TCCTCCTAGAAAAAAAAATCTGG - Intergenic
1134986566 16:18657671-18657693 ACCTCCCTGAAATTAACATCAGG + Intergenic
1135184741 16:20305771-20305793 TCCTTCTGGAAGATAACAGCAGG + Intergenic
1136390713 16:29962387-29962409 GCCTGATGGAAAAGAACTTCTGG - Intronic
1141836700 16:86545436-86545458 CCCTCTTGGAAAATATCATCAGG - Intronic
1142590519 17:1003418-1003440 GATTCCTGGAAACTCACATCTGG + Exonic
1144436805 17:15249767-15249789 GCCTCCTGGACAATGACTGCAGG - Intronic
1147705579 17:42422909-42422931 GCCTCCTGGACAAAATCATCGGG - Exonic
1150999762 17:70361284-70361306 GCCTCAAGGAAAATAACTTAGGG + Intergenic
1151085893 17:71380284-71380306 GTCTCCTGGAAGCTAACACCGGG - Intergenic
1152270026 17:79319099-79319121 GCCTCCGGGAAAGCCACATCCGG - Intronic
1152930880 17:83109321-83109343 GCCTTCAGGAAAATTACATGTGG + Intergenic
1153093135 18:1371199-1371221 TTATCCTGGAAAATGACATCAGG - Intergenic
1156922165 18:42534996-42535018 GCCTGCTGTAAAATAACACTGGG + Intergenic
1158834748 18:61319193-61319215 GTCTTTTGAAAAATAACATCTGG - Intergenic
1159676414 18:71288700-71288722 GCCCCATGGAAAATAACTGCAGG + Intergenic
1159962152 18:74563733-74563755 GCCTCCTAGAAAATAACCCAGGG - Intronic
1162785373 19:13031619-13031641 GCCTTCTAGAAGATATCATCGGG - Intronic
1163359456 19:16836737-16836759 GCCTCGTGGAAGATGACAGCTGG + Intronic
1166333229 19:42090657-42090679 ACCTTCTGGAAAAGAACATTTGG + Exonic
1168351089 19:55675912-55675934 GACTCCTGGAAAGAAACTTCAGG - Intronic
926078357 2:9961614-9961636 GCATCCTTGATAATAACTTCTGG - Intronic
930470208 2:51802767-51802789 GCCTTCTTCAAAATGACATCTGG - Intergenic
930881840 2:56279033-56279055 GCCCCCTGGCAAATCACAGCTGG - Intronic
932608831 2:73183477-73183499 GGCTCCTTGAAAGGAACATCTGG + Intergenic
935310874 2:101782005-101782027 GCCTCCGGGAATATTACGTCAGG - Intronic
936651762 2:114435819-114435841 ACCTCCTGGAAAACAAAATAAGG - Intergenic
943788529 2:191905947-191905969 GGCTCCTGGAAAAGAACATGAGG + Intergenic
946131860 2:217612727-217612749 GCCCCCTGGAAATTAAGAGCAGG + Intronic
948681251 2:239636193-239636215 GCATGCTGGAAAATGACAGCTGG - Intergenic
1168849182 20:965130-965152 GCCTCCTGGAATTCACCATCTGG + Intronic
1170145333 20:13167583-13167605 GCCTCCTTACAAATATCATCTGG - Exonic
1172785300 20:37464644-37464666 GCATCCTGGAAAAAAACATGGGG - Intergenic
1181876417 22:25944167-25944189 ACCTGCTGGAAAATAAGACCAGG + Intronic
1183405776 22:37629895-37629917 TCCTCCTTGCAAATGACATCTGG - Intronic
1183476964 22:38041050-38041072 GCCTCCTGGAAAATAACACAGGG - Intronic
1183583241 22:38737933-38737955 GCTTCCTGGAAAAGGACACCAGG - Intronic
1183604480 22:38860521-38860543 GCAGCCTGGAAATTAACAGCAGG + Intergenic
951257400 3:20466113-20466135 AACTCCTGGAATATAACATATGG - Intergenic
952737926 3:36708745-36708767 GCTTTCTGGAAAATAACTACAGG + Intergenic
955917370 3:63920124-63920146 GCTTACTGGAAAGTAACACCTGG + Intronic
956925528 3:73983392-73983414 CCCTCCTGGAAAATTTCATGTGG + Intergenic
958820876 3:98972334-98972356 GACTCCTGGGAAAGAACCTCTGG - Intergenic
962104774 3:132379297-132379319 GCCTCCTTCAAGATAAAATCTGG - Intergenic
963324338 3:143845006-143845028 ACCTCCTGGAAAAGAGAATCTGG + Intronic
963848944 3:150188745-150188767 GCCTCCTAGAAGATAACATAGGG - Intergenic
965171620 3:165272514-165272536 GCCTCCTGAAAGATTAAATCTGG - Intergenic
965606570 3:170503412-170503434 GCATCCAAGAAAATATCATCAGG - Intronic
967513830 3:190342852-190342874 AACTCCTGGAAAAAAACATAGGG + Intronic
969181897 4:5448666-5448688 CCATCCTTGAAAATAGCATCTGG - Intronic
972034014 4:34497514-34497536 GCTTCATGGAAACTAACAGCTGG + Intergenic
979273996 4:118794223-118794245 GTCTTCTGGAAAATAAAACCTGG - Intronic
979614002 4:122720901-122720923 GCTTCTTTGAAAATAACATGTGG - Intergenic
981739982 4:147991403-147991425 CCCTCCTGGGAAAAAACATGAGG - Intronic
983469523 4:168139366-168139388 CCCTGCTGTAAAATACCATCAGG + Intronic
984118004 4:175706538-175706560 GCCGCCTGGTAAATAATATTAGG - Intronic
989576033 5:42989621-42989643 GCTTCCTGCAACATAACAACTGG + Intergenic
995907413 5:117142325-117142347 ACCTCCTGTAAAGTAAGATCTGG - Intergenic
1000875733 5:166635907-166635929 GCCTTCTGAAAAATAACAAGAGG + Intergenic
1001114837 5:168930879-168930901 GCCTCCTAGACAATAACCTGTGG + Intronic
1001173495 5:169443927-169443949 GCCTCCTGGAAGCAAAAATCTGG - Intergenic
1004681990 6:17904915-17904937 GCCTCCTGGAAATTAGCCTAAGG + Intronic
1007413830 6:41680440-41680462 GCCTCCTAAAAACTAACCTCAGG - Intergenic
1008429403 6:51398159-51398181 GCCTCTTGGAAAATCCCATGTGG - Intergenic
1008726159 6:54422937-54422959 GACTCCTGGACAAAAACATAGGG + Intergenic
1009394135 6:63177791-63177813 GACTCTTGGAAATTAACACCTGG - Intergenic
1015970554 6:138739154-138739176 GCCTCCTGGAAAAAAAAATATGG + Intergenic
1016472672 6:144390874-144390896 GCTTCCTTGAAAGCAACATCTGG + Intronic
1022122911 7:27327057-27327079 GCCTCCTGAAAAATCACAGTGGG + Intergenic
1026873904 7:73869151-73869173 GCCTGCTGGAAGAAAACAACTGG + Intergenic
1027631749 7:80614954-80614976 GCATTCTGGAACATAACAGCAGG - Intronic
1027670221 7:81087290-81087312 GCCTCATGGAAAATAAAAGGTGG - Intergenic
1028305730 7:89261869-89261891 ACCTCATGGAAAATAAAGTCAGG - Intronic
1029134510 7:98359604-98359626 GCCTGCTGAAACCTAACATCTGG + Intronic
1030614362 7:111722990-111723012 ACCTCCTTGAAAACCACATCCGG + Intergenic
1031651174 7:124291640-124291662 AACTCCTGGAAAAAAACATAAGG - Intergenic
1031725001 7:125227606-125227628 AACTCCTGGAAAATAGCATAGGG - Intergenic
1031918129 7:127582209-127582231 GCCACATCGAAAAGAACATCAGG - Exonic
1032455678 7:132071664-132071686 GACTTTTGGAAAATAACTTCTGG - Intergenic
1034019987 7:147631874-147631896 ACATTCTAGAAAATAACATCAGG + Intronic
1039332029 8:36548208-36548230 TCCACTTGGAAAATAACCTCAGG + Intergenic
1040420395 8:47234497-47234519 GACTCCTAGAATATAACATAGGG + Intergenic
1044669879 8:94668711-94668733 GCCTTTTGGGAAATAACATTTGG - Intronic
1044911798 8:97067517-97067539 GCAGCCTGGAAAAAAAAATCTGG - Intronic
1045667289 8:104502346-104502368 ACCTGCTGGAAAGTAACAGCAGG - Intronic
1045990932 8:108306877-108306899 GCCTCCTGGAAAATAACATCTGG - Intronic
1046336803 8:112801179-112801201 GATTGCTGGAAAATTACATCAGG + Intronic
1046884404 8:119348015-119348037 ATCTCCTGGAAAATAACATAGGG - Intergenic
1050754239 9:8980526-8980548 GTCTATTGGAAAATAACATTAGG + Intronic
1053600341 9:39603457-39603479 GCCTCCAGGAAAATAAAGTGTGG + Intergenic
1053857992 9:42357313-42357335 GCCTCCAGGAAAATAAAGTGTGG + Intergenic
1054253187 9:62738927-62738949 GCCTCCAGGAAAATAAAGTGTGG - Intergenic
1054567303 9:66773426-66773448 GCCTCCAGGAAAATAAAGTGTGG - Intergenic
1187369492 X:18693064-18693086 TTCTCTTGGAAAATTACATCAGG + Intronic
1189321738 X:40091285-40091307 GCCTTCCACAAAATAACATCGGG + Intronic
1195724451 X:107899715-107899737 TCCTCCTTGAAAATACCATTAGG - Intronic
1196347536 X:114681985-114682007 TCCTCCTGGAAATTAAAATAAGG - Intronic
1200118425 X:153779288-153779310 GCCTGCTGGAAAATCACATCCGG + Exonic
1201431094 Y:13902816-13902838 GCTACCTGGAATGTAACATCCGG + Intergenic