ID: 1045993836

View in Genome Browser
Species Human (GRCh38)
Location 8:108340278-108340300
Sequence GCCTGAACTTCCCTAGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243192
Summary {0: 1, 1: 6, 2: 818, 3: 20765, 4: 221602}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045993836_1045993839 -1 Left 1045993836 8:108340278-108340300 CCAGCTACTAGGGAAGTTCAGGC 0: 1
1: 6
2: 818
3: 20765
4: 221602
Right 1045993839 8:108340300-108340322 CCAGAGGATCACTTGAGTCCAGG 0: 13
1: 252
2: 2929
3: 20462
4: 66984
1045993836_1045993840 2 Left 1045993836 8:108340278-108340300 CCAGCTACTAGGGAAGTTCAGGC 0: 1
1: 6
2: 818
3: 20765
4: 221602
Right 1045993840 8:108340303-108340325 GAGGATCACTTGAGTCCAGGAGG 0: 337
1: 5214
2: 15198
3: 51393
4: 101714
1045993836_1045993841 8 Left 1045993836 8:108340278-108340300 CCAGCTACTAGGGAAGTTCAGGC 0: 1
1: 6
2: 818
3: 20765
4: 221602
Right 1045993841 8:108340309-108340331 CACTTGAGTCCAGGAGGTCGAGG 0: 56
1: 1202
2: 8210
3: 32689
4: 83127
1045993836_1045993842 15 Left 1045993836 8:108340278-108340300 CCAGCTACTAGGGAAGTTCAGGC 0: 1
1: 6
2: 818
3: 20765
4: 221602
Right 1045993842 8:108340316-108340338 GTCCAGGAGGTCGAGGCTGCAGG 0: 4
1: 64
2: 275
3: 757
4: 1753
1045993836_1045993844 21 Left 1045993836 8:108340278-108340300 CCAGCTACTAGGGAAGTTCAGGC 0: 1
1: 6
2: 818
3: 20765
4: 221602
Right 1045993844 8:108340322-108340344 GAGGTCGAGGCTGCAGGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045993836 Original CRISPR GCCTGAACTTCCCTAGTAGC TGG (reversed) Intronic
Too many off-targets to display for this crispr