ID: 1045993836

View in Genome Browser
Species Human (GRCh38)
Location 8:108340278-108340300
Sequence GCCTGAACTTCCCTAGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045993836_1045993840 2 Left 1045993836 8:108340278-108340300 CCAGCTACTAGGGAAGTTCAGGC No data
Right 1045993840 8:108340303-108340325 GAGGATCACTTGAGTCCAGGAGG No data
1045993836_1045993844 21 Left 1045993836 8:108340278-108340300 CCAGCTACTAGGGAAGTTCAGGC No data
Right 1045993844 8:108340322-108340344 GAGGTCGAGGCTGCAGGTTGAGG No data
1045993836_1045993841 8 Left 1045993836 8:108340278-108340300 CCAGCTACTAGGGAAGTTCAGGC No data
Right 1045993841 8:108340309-108340331 CACTTGAGTCCAGGAGGTCGAGG No data
1045993836_1045993839 -1 Left 1045993836 8:108340278-108340300 CCAGCTACTAGGGAAGTTCAGGC No data
Right 1045993839 8:108340300-108340322 CCAGAGGATCACTTGAGTCCAGG No data
1045993836_1045993842 15 Left 1045993836 8:108340278-108340300 CCAGCTACTAGGGAAGTTCAGGC No data
Right 1045993842 8:108340316-108340338 GTCCAGGAGGTCGAGGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045993836 Original CRISPR GCCTGAACTTCCCTAGTAGC TGG (reversed) Intronic