ID: 1045993839

View in Genome Browser
Species Human (GRCh38)
Location 8:108340300-108340322
Sequence CCAGAGGATCACTTGAGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90640
Summary {0: 13, 1: 252, 2: 2929, 3: 20462, 4: 66984}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045993834_1045993839 0 Left 1045993834 8:108340277-108340299 CCCAGCTACTAGGGAAGTTCAGG 0: 1
1: 12
2: 1052
3: 24602
4: 244738
Right 1045993839 8:108340300-108340322 CCAGAGGATCACTTGAGTCCAGG 0: 13
1: 252
2: 2929
3: 20462
4: 66984
1045993833_1045993839 8 Left 1045993833 8:108340269-108340291 CCTATGGTCCCAGCTACTAGGGA 0: 26
1: 1111
2: 19791
3: 147026
4: 259039
Right 1045993839 8:108340300-108340322 CCAGAGGATCACTTGAGTCCAGG 0: 13
1: 252
2: 2929
3: 20462
4: 66984
1045993836_1045993839 -1 Left 1045993836 8:108340278-108340300 CCAGCTACTAGGGAAGTTCAGGC 0: 1
1: 6
2: 818
3: 20765
4: 221602
Right 1045993839 8:108340300-108340322 CCAGAGGATCACTTGAGTCCAGG 0: 13
1: 252
2: 2929
3: 20462
4: 66984

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045993839 Original CRISPR CCAGAGGATCACTTGAGTCC AGG Intronic
Too many off-targets to display for this crispr