ID: 1045993840

View in Genome Browser
Species Human (GRCh38)
Location 8:108340303-108340325
Sequence GAGGATCACTTGAGTCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173856
Summary {0: 337, 1: 5214, 2: 15198, 3: 51393, 4: 101714}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045993833_1045993840 11 Left 1045993833 8:108340269-108340291 CCTATGGTCCCAGCTACTAGGGA 0: 26
1: 1111
2: 19791
3: 147026
4: 259039
Right 1045993840 8:108340303-108340325 GAGGATCACTTGAGTCCAGGAGG 0: 337
1: 5214
2: 15198
3: 51393
4: 101714
1045993836_1045993840 2 Left 1045993836 8:108340278-108340300 CCAGCTACTAGGGAAGTTCAGGC 0: 1
1: 6
2: 818
3: 20765
4: 221602
Right 1045993840 8:108340303-108340325 GAGGATCACTTGAGTCCAGGAGG 0: 337
1: 5214
2: 15198
3: 51393
4: 101714
1045993834_1045993840 3 Left 1045993834 8:108340277-108340299 CCCAGCTACTAGGGAAGTTCAGG 0: 1
1: 12
2: 1052
3: 24602
4: 244738
Right 1045993840 8:108340303-108340325 GAGGATCACTTGAGTCCAGGAGG 0: 337
1: 5214
2: 15198
3: 51393
4: 101714

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045993840 Original CRISPR GAGGATCACTTGAGTCCAGG AGG Intronic
Too many off-targets to display for this crispr