ID: 1045993842

View in Genome Browser
Species Human (GRCh38)
Location 8:108340316-108340338
Sequence GTCCAGGAGGTCGAGGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2853
Summary {0: 4, 1: 64, 2: 275, 3: 757, 4: 1753}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045993834_1045993842 16 Left 1045993834 8:108340277-108340299 CCCAGCTACTAGGGAAGTTCAGG 0: 1
1: 12
2: 1052
3: 24602
4: 244738
Right 1045993842 8:108340316-108340338 GTCCAGGAGGTCGAGGCTGCAGG 0: 4
1: 64
2: 275
3: 757
4: 1753
1045993836_1045993842 15 Left 1045993836 8:108340278-108340300 CCAGCTACTAGGGAAGTTCAGGC 0: 1
1: 6
2: 818
3: 20765
4: 221602
Right 1045993842 8:108340316-108340338 GTCCAGGAGGTCGAGGCTGCAGG 0: 4
1: 64
2: 275
3: 757
4: 1753
1045993833_1045993842 24 Left 1045993833 8:108340269-108340291 CCTATGGTCCCAGCTACTAGGGA 0: 26
1: 1111
2: 19791
3: 147026
4: 259039
Right 1045993842 8:108340316-108340338 GTCCAGGAGGTCGAGGCTGCAGG 0: 4
1: 64
2: 275
3: 757
4: 1753
1045993838_1045993842 -7 Left 1045993838 8:108340300-108340322 CCAGAGGATCACTTGAGTCCAGG 0: 14
1: 256
2: 816
3: 1954
4: 3406
Right 1045993842 8:108340316-108340338 GTCCAGGAGGTCGAGGCTGCAGG 0: 4
1: 64
2: 275
3: 757
4: 1753

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045993842 Original CRISPR GTCCAGGAGGTCGAGGCTGC AGG Intronic
Too many off-targets to display for this crispr