ID: 1046007054

View in Genome Browser
Species Human (GRCh38)
Location 8:108499830-108499852
Sequence CAGAATCCTCCAATCTTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046007054_1046007061 21 Left 1046007054 8:108499830-108499852 CCACTAAAGATTGGAGGATTCTG No data
Right 1046007061 8:108499874-108499896 TTGGTCTTGATATTGAAAGTTGG No data
1046007054_1046007058 -4 Left 1046007054 8:108499830-108499852 CCACTAAAGATTGGAGGATTCTG No data
Right 1046007058 8:108499849-108499871 TCTGTAAAGACAAGGGAGAAGGG No data
1046007054_1046007057 -5 Left 1046007054 8:108499830-108499852 CCACTAAAGATTGGAGGATTCTG No data
Right 1046007057 8:108499848-108499870 TTCTGTAAAGACAAGGGAGAAGG No data
1046007054_1046007059 -3 Left 1046007054 8:108499830-108499852 CCACTAAAGATTGGAGGATTCTG No data
Right 1046007059 8:108499850-108499872 CTGTAAAGACAAGGGAGAAGGGG No data
1046007054_1046007060 2 Left 1046007054 8:108499830-108499852 CCACTAAAGATTGGAGGATTCTG No data
Right 1046007060 8:108499855-108499877 AAGACAAGGGAGAAGGGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046007054 Original CRISPR CAGAATCCTCCAATCTTTAG TGG (reversed) Intergenic
No off target data available for this crispr