ID: 1046007057

View in Genome Browser
Species Human (GRCh38)
Location 8:108499848-108499870
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046007054_1046007057 -5 Left 1046007054 8:108499830-108499852 CCACTAAAGATTGGAGGATTCTG No data
Right 1046007057 8:108499848-108499870 TTCTGTAAAGACAAGGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046007057 Original CRISPR TTCTGTAAAGACAAGGGAGA AGG Intergenic
No off target data available for this crispr