ID: 1046009166

View in Genome Browser
Species Human (GRCh38)
Location 8:108525515-108525537
Sequence GAGCCACATGTGGATCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046009166_1046009170 -7 Left 1046009166 8:108525515-108525537 CCTTCCTGATCCACATGTGGCTC No data
Right 1046009170 8:108525531-108525553 GTGGCTCATAGACCACAGGTTGG No data
1046009166_1046009173 22 Left 1046009166 8:108525515-108525537 CCTTCCTGATCCACATGTGGCTC No data
Right 1046009173 8:108525560-108525582 TTGTTTTAGCCCAAAGGAACTGG No data
1046009166_1046009172 16 Left 1046009166 8:108525515-108525537 CCTTCCTGATCCACATGTGGCTC No data
Right 1046009172 8:108525554-108525576 ACAAGCTTGTTTTAGCCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046009166 Original CRISPR GAGCCACATGTGGATCAGGA AGG (reversed) Intergenic
No off target data available for this crispr