ID: 1046010921

View in Genome Browser
Species Human (GRCh38)
Location 8:108546104-108546126
Sequence AATTATTTCGTGTTTAGACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046010921_1046010922 20 Left 1046010921 8:108546104-108546126 CCGAGTCTAAACACGAAATAATT No data
Right 1046010922 8:108546147-108546169 TGACTGCAACCCATCACATCAGG No data
1046010921_1046010923 25 Left 1046010921 8:108546104-108546126 CCGAGTCTAAACACGAAATAATT No data
Right 1046010923 8:108546152-108546174 GCAACCCATCACATCAGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046010921 Original CRISPR AATTATTTCGTGTTTAGACT CGG (reversed) Intergenic