ID: 1046010921 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:108546104-108546126 |
| Sequence | AATTATTTCGTGTTTAGACT CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1046010921_1046010922 | 20 | Left | 1046010921 | 8:108546104-108546126 | CCGAGTCTAAACACGAAATAATT | No data | ||
| Right | 1046010922 | 8:108546147-108546169 | TGACTGCAACCCATCACATCAGG | No data | ||||
| 1046010921_1046010923 | 25 | Left | 1046010921 | 8:108546104-108546126 | CCGAGTCTAAACACGAAATAATT | No data | ||
| Right | 1046010923 | 8:108546152-108546174 | GCAACCCATCACATCAGGTGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1046010921 | Original CRISPR | AATTATTTCGTGTTTAGACT CGG (reversed) | Intergenic | ||