ID: 1046015592

View in Genome Browser
Species Human (GRCh38)
Location 8:108601079-108601101
Sequence GAATTGGGATCCTTTCTAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046015592_1046015598 20 Left 1046015592 8:108601079-108601101 CCCATTAGAAAGGATCCCAATTC No data
Right 1046015598 8:108601122-108601144 AAAAAAGAAGAAGGAGAAGGAGG 0: 3
1: 94
2: 605
3: 2720
4: 9743
1046015592_1046015597 17 Left 1046015592 8:108601079-108601101 CCCATTAGAAAGGATCCCAATTC No data
Right 1046015597 8:108601119-108601141 ATAAAAAAAGAAGAAGGAGAAGG No data
1046015592_1046015599 23 Left 1046015592 8:108601079-108601101 CCCATTAGAAAGGATCCCAATTC No data
Right 1046015599 8:108601125-108601147 AAAGAAGAAGGAGAAGGAGGAGG 0: 15
1: 214
2: 1471
3: 4774
4: 11133
1046015592_1046015596 11 Left 1046015592 8:108601079-108601101 CCCATTAGAAAGGATCCCAATTC No data
Right 1046015596 8:108601113-108601135 TTTTTTATAAAAAAAGAAGAAGG No data
1046015592_1046015601 29 Left 1046015592 8:108601079-108601101 CCCATTAGAAAGGATCCCAATTC No data
Right 1046015601 8:108601131-108601153 GAAGGAGAAGGAGGAGGGAGAGG No data
1046015592_1046015600 24 Left 1046015592 8:108601079-108601101 CCCATTAGAAAGGATCCCAATTC No data
Right 1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG No data
1046015592_1046015602 30 Left 1046015592 8:108601079-108601101 CCCATTAGAAAGGATCCCAATTC No data
Right 1046015602 8:108601132-108601154 AAGGAGAAGGAGGAGGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046015592 Original CRISPR GAATTGGGATCCTTTCTAAT GGG (reversed) Intergenic
No off target data available for this crispr