ID: 1046015595

View in Genome Browser
Species Human (GRCh38)
Location 8:108601095-108601117
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046015595_1046015596 -5 Left 1046015595 8:108601095-108601117 CCAATTCGAAAGTTATGATTTTT No data
Right 1046015596 8:108601113-108601135 TTTTTTATAAAAAAAGAAGAAGG No data
1046015595_1046015608 22 Left 1046015595 8:108601095-108601117 CCAATTCGAAAGTTATGATTTTT No data
Right 1046015608 8:108601140-108601162 GGAGGAGGGAGAGGGGGAGGGGG 0: 5
1: 165
2: 1545
3: 6517
4: 18713
1046015595_1046015611 27 Left 1046015595 8:108601095-108601117 CCAATTCGAAAGTTATGATTTTT No data
Right 1046015611 8:108601145-108601167 AGGGAGAGGGGGAGGGGGAGGGG 0: 103
1: 552
2: 1138
3: 3709
4: 20813
1046015595_1046015605 19 Left 1046015595 8:108601095-108601117 CCAATTCGAAAGTTATGATTTTT No data
Right 1046015605 8:108601137-108601159 GAAGGAGGAGGGAGAGGGGGAGG No data
1046015595_1046015602 14 Left 1046015595 8:108601095-108601117 CCAATTCGAAAGTTATGATTTTT No data
Right 1046015602 8:108601132-108601154 AAGGAGAAGGAGGAGGGAGAGGG No data
1046015595_1046015609 25 Left 1046015595 8:108601095-108601117 CCAATTCGAAAGTTATGATTTTT No data
Right 1046015609 8:108601143-108601165 GGAGGGAGAGGGGGAGGGGGAGG 0: 13
1: 457
2: 1386
3: 6512
4: 20490
1046015595_1046015598 4 Left 1046015595 8:108601095-108601117 CCAATTCGAAAGTTATGATTTTT No data
Right 1046015598 8:108601122-108601144 AAAAAAGAAGAAGGAGAAGGAGG 0: 3
1: 94
2: 605
3: 2720
4: 9743
1046015595_1046015599 7 Left 1046015595 8:108601095-108601117 CCAATTCGAAAGTTATGATTTTT No data
Right 1046015599 8:108601125-108601147 AAAGAAGAAGGAGAAGGAGGAGG 0: 15
1: 214
2: 1471
3: 4774
4: 11133
1046015595_1046015610 26 Left 1046015595 8:108601095-108601117 CCAATTCGAAAGTTATGATTTTT No data
Right 1046015610 8:108601144-108601166 GAGGGAGAGGGGGAGGGGGAGGG 0: 113
1: 535
2: 3057
3: 4644
4: 17045
1046015595_1046015597 1 Left 1046015595 8:108601095-108601117 CCAATTCGAAAGTTATGATTTTT No data
Right 1046015597 8:108601119-108601141 ATAAAAAAAGAAGAAGGAGAAGG No data
1046015595_1046015600 8 Left 1046015595 8:108601095-108601117 CCAATTCGAAAGTTATGATTTTT No data
Right 1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG No data
1046015595_1046015603 15 Left 1046015595 8:108601095-108601117 CCAATTCGAAAGTTATGATTTTT No data
Right 1046015603 8:108601133-108601155 AGGAGAAGGAGGAGGGAGAGGGG No data
1046015595_1046015601 13 Left 1046015595 8:108601095-108601117 CCAATTCGAAAGTTATGATTTTT No data
Right 1046015601 8:108601131-108601153 GAAGGAGAAGGAGGAGGGAGAGG No data
1046015595_1046015607 21 Left 1046015595 8:108601095-108601117 CCAATTCGAAAGTTATGATTTTT No data
Right 1046015607 8:108601139-108601161 AGGAGGAGGGAGAGGGGGAGGGG No data
1046015595_1046015604 16 Left 1046015595 8:108601095-108601117 CCAATTCGAAAGTTATGATTTTT No data
Right 1046015604 8:108601134-108601156 GGAGAAGGAGGAGGGAGAGGGGG 0: 6
1: 75
2: 1007
3: 6228
4: 16209
1046015595_1046015606 20 Left 1046015595 8:108601095-108601117 CCAATTCGAAAGTTATGATTTTT No data
Right 1046015606 8:108601138-108601160 AAGGAGGAGGGAGAGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046015595 Original CRISPR AAAAATCATAACTTTCGAAT TGG (reversed) Intergenic
No off target data available for this crispr