ID: 1046015600

View in Genome Browser
Species Human (GRCh38)
Location 8:108601126-108601148
Sequence AAGAAGAAGGAGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046015595_1046015600 8 Left 1046015595 8:108601095-108601117 CCAATTCGAAAGTTATGATTTTT No data
Right 1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG No data
1046015594_1046015600 9 Left 1046015594 8:108601094-108601116 CCCAATTCGAAAGTTATGATTTT No data
Right 1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG No data
1046015593_1046015600 23 Left 1046015593 8:108601080-108601102 CCATTAGAAAGGATCCCAATTCG No data
Right 1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG No data
1046015592_1046015600 24 Left 1046015592 8:108601079-108601101 CCCATTAGAAAGGATCCCAATTC No data
Right 1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046015600 Original CRISPR AAGAAGAAGGAGAAGGAGGA GGG Intergenic
No off target data available for this crispr