ID: 1046016074

View in Genome Browser
Species Human (GRCh38)
Location 8:108606896-108606918
Sequence AACTCAGGAATAGCTTGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 206}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046016068_1046016074 11 Left 1046016068 8:108606862-108606884 CCATTTTATTGTACTCATGGTTT 0: 1
1: 0
2: 8
3: 53
4: 424
Right 1046016074 8:108606896-108606918 AACTCAGGAATAGCTTGACTGGG 0: 1
1: 0
2: 1
3: 21
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046016074 Original CRISPR AACTCAGGAATAGCTTGACT GGG Intronic
902136740 1:14312946-14312968 AATCCAGGCATAGCTTAACTGGG - Intergenic
905458899 1:38107966-38107988 ACATCAGGCATAGTTTGACTGGG - Intergenic
907976972 1:59440887-59440909 AACTCAAGAGTATCTTGAATGGG - Intronic
909388839 1:75093902-75093924 AATTCAGGAGTGGCTTAACTTGG - Intergenic
909839781 1:80305576-80305598 AACTCTGGAACATCTTGACTGGG + Intergenic
909860070 1:80594017-80594039 AAGTCAGAAATAGCTTCCCTGGG - Intergenic
910623238 1:89278800-89278822 AACTCAGGTTAGGCTTGACTGGG - Intergenic
910936839 1:92490645-92490667 AACTAAGGAAAAGTTTGACTTGG + Intergenic
911704149 1:100991490-100991512 CACTCAAGAATCTCTTGACTGGG + Intronic
915339402 1:155167978-155168000 CCCTCAGGGATAGCTTGCCTAGG + Intergenic
915957136 1:160230590-160230612 AATTCAGAAATAGTTTGACTTGG - Intronic
916320183 1:163496736-163496758 AGATCAGGAATAGCATGATTAGG - Intergenic
920961659 1:210669270-210669292 AACTAAGTAATAACTTTACTTGG - Intronic
922302248 1:224311708-224311730 AACTCAGTATTAGCTGGACATGG - Intronic
922907601 1:229186399-229186421 AAGTCAGGAATGGCTTGGCAAGG + Intergenic
923427266 1:233883574-233883596 AACACAGGAAAAGCCTGTCTTGG + Intergenic
924103265 1:240625730-240625752 AGTACAGAAATAGCTTGACTAGG + Intergenic
1064776065 10:18778545-18778567 AATCCAGGAATGGCTTCACTGGG - Intergenic
1065105269 10:22377334-22377356 AACTCAGGAGCAGCTTAGCTAGG - Intronic
1066104706 10:32146316-32146338 CACTCAGGAATGTCTGGACTGGG - Intergenic
1066465819 10:35649421-35649443 AATTTAGGAAAGGCTTGACTGGG + Intergenic
1068173256 10:53422698-53422720 AAGTCAGGAATGGCTTTACTGGG + Intergenic
1068733118 10:60382092-60382114 AAATCAGAAATACCTTGTCTTGG - Intronic
1070972246 10:80577347-80577369 AATTCAGGAAGGGCTTGGCTGGG - Intronic
1075425460 10:122338665-122338687 AATTCAGGGGTAGCTTCACTGGG + Intergenic
1076592638 10:131596959-131596981 AACTCAGGAATCCCATTACTGGG + Intergenic
1076592959 10:131601649-131601671 AACTCAGGAATCCCATTACTGGG + Intergenic
1077787513 11:5400537-5400559 AAGTCAGGAAAAGCTTTCCTTGG - Intronic
1078587897 11:12610030-12610052 AAGTCAGGGATAGCTTCCCTGGG - Intergenic
1081491322 11:43571447-43571469 CACTCAGGAATACCTAGAGTTGG - Intronic
1081684330 11:45031109-45031131 AATTCAGGAAAAACCTGACTTGG - Intergenic
1084296449 11:68215665-68215687 TGCTCAGGCATAGCTGGACTTGG - Intergenic
1084522429 11:69672326-69672348 AACTCAGGAGCAGCTTTGCTGGG - Intronic
1085997590 11:81938746-81938768 AATTCTGGAATAGCTTGGATAGG + Intergenic
1088861757 11:113806789-113806811 AGCGTAGGAATAGCTTGTCTTGG - Intronic
1089484400 11:118833674-118833696 ACCTCAGGAACAGTGTGACTGGG + Intergenic
1089979293 11:122759024-122759046 AGCCCAGGCATGGCTTGACTGGG + Intronic
1091229585 11:133979296-133979318 AATTCAGGAGTGGCTTGGCTGGG - Intergenic
1092647451 12:10591564-10591586 ACCTCTGGAATAGTTTGCCTGGG + Intergenic
1092660959 12:10737637-10737659 AACTGAAGAATACCCTGACTAGG + Intergenic
1092687704 12:11070208-11070230 AGCTCAGGAATAGGGTGAGTAGG + Intronic
1094771992 12:33672969-33672991 AACTCAGGAATTGCTCTAATGGG + Intergenic
1096392422 12:51239442-51239464 AACGCAGGAATAGGTTGAGGGGG + Intronic
1098703689 12:73660974-73660996 AATTCAGGTAAAGCTTAACTGGG + Intergenic
1100126368 12:91431224-91431246 AATTCAGGAATAGTTTGATTTGG - Intergenic
1100166382 12:91922622-91922644 AACTTAGGGATATCTTGCCTAGG - Intergenic
1100479202 12:94961545-94961567 AAGTCAGGAAGAGCTTGAGTTGG + Intronic
1100938009 12:99691819-99691841 AGTTCAGGCATAGCTTAACTGGG - Intronic
1101542096 12:105674575-105674597 AATTCAGGAAAGGCTTGGCTTGG - Intergenic
1102712461 12:114940078-114940100 AATTCAGGAGTAGCTTAGCTGGG + Intergenic
1102775734 12:115517119-115517141 AACTCAAGAGTGGCCTGACTGGG + Intergenic
1107327846 13:39264332-39264354 AACTCAGGCACAGTTTAACTGGG + Intergenic
1107989822 13:45810008-45810030 GACTCAGGACTAGCTCGACCAGG - Intronic
1108620058 13:52173275-52173297 AACTCTGAAATAGCTGGCCTAGG + Intergenic
1109505237 13:63292096-63292118 AACTCAGGAATATCTTTTCTAGG - Intergenic
1109877219 13:68421045-68421067 TACTCAGTAATGGCTTTACTGGG + Intergenic
1109971887 13:69781404-69781426 ACTTGAGAAATAGCTTGACTAGG + Intronic
1110397366 13:75046859-75046881 AATTCAGGGACAGCTTAACTGGG - Intergenic
1121319679 14:92984287-92984309 CACTCAGGAATTCCCTGACTGGG - Intronic
1122564834 14:102645749-102645771 AATTTAGGAAGAGCTTGATTGGG + Intronic
1124103384 15:26716068-26716090 AGCTCATGTATAGCTTGAGTTGG - Intronic
1127924365 15:63524507-63524529 AATTCAGGAAGAACTTGCCTGGG + Intronic
1128050698 15:64661981-64662003 AATTCAGGAGTAGCTTAACTGGG + Intronic
1128905164 15:71461066-71461088 AATTCAGGAGCAGCTTAACTGGG + Intronic
1129798024 15:78392693-78392715 TAATCAGAAATAGCTTGATTGGG - Intergenic
1130037714 15:80376867-80376889 AGCTCAGAAACATCTTGACTTGG - Exonic
1130980326 15:88807888-88807910 AACTCATGAATAGGTGGATTTGG + Intronic
1133702230 16:8319564-8319586 AACACATGAATAGCTTCCCTGGG + Intergenic
1139137159 16:64218345-64218367 AATTCAAGAACAGCTTTACTGGG - Intergenic
1140274092 16:73493515-73493537 AACTCAGTAATAGCTAGATTGGG + Intergenic
1141353344 16:83319778-83319800 AACACAGGGAAAGCTTGAATGGG + Intronic
1141923159 16:87149827-87149849 AACTCAGGAGCAGCTCAACTGGG - Intronic
1142878177 17:2864883-2864905 AACTCAGGAATAACGTGAGAAGG + Intronic
1144871213 17:18372650-18372672 AATTCAGGAATTGCTTGATCAGG + Intergenic
1145920811 17:28608249-28608271 AATTCAGGAAAAGCATAACTGGG + Intronic
1150076631 17:62197901-62197923 AGCTCAGGAGTGGCTTGAATGGG + Intergenic
1153377280 18:4394901-4394923 AGCTCAGGAATACCTTCATTCGG + Intronic
1153871033 18:9320309-9320331 AATTCAGGAAGGGCTTGGCTGGG - Intergenic
1154236585 18:12611582-12611604 AATTCAGGAATGGCTTAGCTGGG - Intronic
1154406373 18:14095713-14095735 AGCTCAGTACTAGCTTGACATGG - Intronic
1158870425 18:61681823-61681845 ACCTCAGGAAGGGCTGGACTGGG + Intergenic
1160964434 19:1740219-1740241 GGCTCAGGAGTGGCTTGACTGGG + Intergenic
1164953516 19:32360482-32360504 AACTCTGAAATACCTTGTCTAGG + Exonic
1165674612 19:37710784-37710806 AACTGAGGAATATTTTGACTTGG + Intronic
1167824481 19:51959925-51959947 TACTCTGAAATAGTTTGACTAGG - Intergenic
927363609 2:22267489-22267511 TACTCAGGAAGATCTTGCCTAGG - Intergenic
927949530 2:27158412-27158434 AACTCTAGAATAGCTTGTCGAGG + Intergenic
929671684 2:43880921-43880943 GACTCAGGGAAAGCTGGACTTGG - Intergenic
930574367 2:53127710-53127732 AAGTCAGAAATGGCTTGCCTCGG + Intergenic
932899808 2:75684685-75684707 TACTCAGTAATAGCATGGCTGGG - Intronic
934869048 2:97843203-97843225 AACTTACTAATAGCATGACTTGG + Intronic
937878261 2:126843142-126843164 AACCCAGGAGTAGCCTCACTGGG + Intergenic
938900072 2:135792257-135792279 AAGTCAGGAATGGCTTCCCTGGG - Intronic
939230484 2:139418995-139419017 TCCTCAGGAAAAGCATGACTTGG - Intergenic
940384858 2:153058467-153058489 AAAACAGGAATGGCTTTACTGGG + Intergenic
941311133 2:163933714-163933736 ACCCTAGGAACAGCTTGACTAGG - Intergenic
944646615 2:201786702-201786724 AATTCAGGAAGTGTTTGACTAGG - Intergenic
1169626265 20:7573177-7573199 AATTCAGGAAAGGCTTGGCTAGG - Intergenic
1169697416 20:8406091-8406113 AATGCAGGAATGACTTGACTTGG - Intronic
1169710240 20:8552976-8552998 AGCTCAGGAATAGCTATATTTGG - Intronic
1170825050 20:19786560-19786582 AATTCAGGAAGGGCTTGGCTGGG - Intergenic
1171378725 20:24715293-24715315 AAGTCAGGAATGGCTTTCCTGGG + Intergenic
1172110400 20:32541423-32541445 AACTCAGGGAGCACTTGACTGGG - Intronic
1173306466 20:41855295-41855317 AACTCAGGAGTAGCTTGGCTGGG - Intergenic
1174315431 20:49696632-49696654 ACCTCAGGAATTGCTGGGCTGGG - Intronic
1175071152 20:56335029-56335051 AATTCAGAAACAGCTTAACTGGG - Intergenic
1177124343 21:17177746-17177768 AAGTCAGAAATAGCTTCCCTGGG - Intergenic
1177630266 21:23717911-23717933 AACTCAGGTGTAGCTTAACAGGG - Intergenic
1178440320 21:32593228-32593250 ACCTCTGGGATAGCTGGACTGGG + Intronic
1178981808 21:37270629-37270651 AACTCAGGAGCAGCTTCCCTGGG + Intergenic
1179036146 21:37760163-37760185 AATTCAGGACCAGCTTGGCTGGG - Intronic
1181454249 22:23047344-23047366 AACTCAGAAATGGCTTCGCTGGG - Intergenic
1183840231 22:40493790-40493812 TACTCAGGAATAGGATTACTGGG - Intronic
949154854 3:815510-815532 AGCTAAGGAATATCTTGACTAGG - Intergenic
949377278 3:3404838-3404860 AAGTCAGGAATGGCTTCCCTGGG - Intergenic
952763374 3:36934864-36934886 AACTCAGGGATAGCTATTCTGGG - Intronic
953379176 3:42454017-42454039 CACTCAGCAATTGCTTGTCTGGG + Intergenic
954101611 3:48377536-48377558 AATTCAGGGGTAGCTTGACTGGG - Intronic
954685805 3:52369599-52369621 ACCTCAGGAATCTCCTGACTTGG + Intronic
954966501 3:54616165-54616187 AACCCAGGAGTAGCCTGACTGGG + Intronic
955025088 3:55159900-55159922 AACTCAGGAATAGACTGGCCAGG - Intergenic
955276629 3:57553312-57553334 TACTCAGGAACAGGGTGACTGGG - Intergenic
955818395 3:62872456-62872478 AGCTCTGGGATAGCTTCACTGGG + Intronic
958130434 3:89413191-89413213 AACTCATGAACAGCTTGGGTAGG - Exonic
958444926 3:94203316-94203338 AAGTCAGAAATAGCTTCACTGGG + Intergenic
959130766 3:102353452-102353474 AACTTAAGAATAGCTTAATTTGG - Intronic
959390756 3:105770456-105770478 TATTCAGGAATAGCTTCCCTGGG - Intronic
963270661 3:143282945-143282967 AACACAGGAATTTCTTCACTGGG + Intronic
964547754 3:157853483-157853505 AACTGAGGAAGAGCTGGAATTGG - Intergenic
964955086 3:162344818-162344840 ACCTCAGTATTATCTTGACTGGG - Intergenic
966280415 3:178219998-178220020 TACCCAGGAATATCATGACTGGG - Intergenic
970668921 4:18373475-18373497 AACTCAGGAATCCCATTACTGGG + Intergenic
971163763 4:24161115-24161137 AAATAAGGAAGAGCATGACTTGG + Intergenic
971166955 4:24193671-24193693 AACCCAGGAAGAAATTGACTTGG - Intergenic
971472150 4:27039282-27039304 AACTCAGAAATTTCTTGATTTGG + Intergenic
972256651 4:37363280-37363302 AACTCAGCAATATCATGACTGGG + Intronic
973050439 4:45589051-45589073 AAGTCAGTAATAGCTTGATGGGG - Intergenic
975941523 4:79653049-79653071 AACTCTGGAGTATCTTAACTTGG + Intergenic
975958373 4:79869991-79870013 AACACAAGAATAGCTTGCTTTGG - Intergenic
980926633 4:139144360-139144382 GAATCAGGAATAGCTTCCCTTGG - Intronic
981350645 4:143725567-143725589 AACTCAGCAAAAGCCTGACAAGG - Intergenic
981933110 4:150211054-150211076 AATTCAGGAGCAGCTTAACTGGG + Intronic
983147187 4:164230729-164230751 AACTCAGGAGTGGCTTAACTGGG - Intronic
983963177 4:173778690-173778712 AACTCAGAAATGGCTTCCCTGGG + Intergenic
984197323 4:176674413-176674435 AACTCAGCAATAGCTATGCTGGG - Intergenic
987991387 5:25217097-25217119 AACTCAGAAATCCCATGACTGGG + Intergenic
988042821 5:25910737-25910759 GACTCAGGAATAGCTGGCCTTGG + Intergenic
992678227 5:79127114-79127136 AATTCAGGGATAGCATAACTAGG + Intronic
992876767 5:81064044-81064066 AACCCAGGCATAGCTTAGCTGGG + Intronic
992913230 5:81419756-81419778 AAATCAGTAAAAGCTTAACTGGG - Exonic
994151026 5:96447605-96447627 GACTGAGGAATAATTTGACTGGG + Intergenic
994220899 5:97193481-97193503 AAGTCAGGAATGGCTTCCCTGGG + Intergenic
994399154 5:99257132-99257154 TAGTCAGGAATAGCTTCCCTGGG + Intergenic
994868502 5:105312680-105312702 AACTTAGGCAAAGCTTTACTAGG - Intergenic
995997691 5:118321326-118321348 ACCTAAGGAATGACTTGACTTGG - Intergenic
996698888 5:126429015-126429037 AACTCAGCAATCCCTTTACTGGG + Intronic
996855284 5:127998915-127998937 AACCCAGGAGCAGCTTAACTGGG - Intergenic
998661295 5:144241235-144241257 AAGTCAGGAATTGCATTACTTGG - Intronic
999493117 5:152071038-152071060 AACTCCTGTATAGCCTGACTTGG + Intergenic
1000067496 5:157707647-157707669 AATTCAGGAGTAGCTTAGCTAGG - Intergenic
1000237467 5:159376043-159376065 TAATCAGGAATAGCTTCCCTGGG - Intergenic
1001684041 5:173579284-173579306 AATTCAGGAACAGCTTAGCTGGG + Intergenic
1001854554 5:174999677-174999699 AACACAGGAACAGCTTAGCTAGG + Intergenic
1004691551 6:17996493-17996515 CATTTAGGAATAGCTTGACTAGG + Intergenic
1007206472 6:40156251-40156273 AACCCTGGACTAGCTGGACTCGG - Intergenic
1008231141 6:48986315-48986337 AAGTCAGAAATAGCTTCCCTGGG - Intergenic
1009170408 6:60392259-60392281 ACCTCAGGAGGAGGTTGACTAGG - Intergenic
1009800286 6:68528150-68528172 AAGTCAGAAATAGCTTCCCTGGG + Intergenic
1011969431 6:93203864-93203886 AACTTGGGAATAATTTGACTGGG - Intergenic
1012140264 6:95618174-95618196 ATATCAGGAATGGCTTCACTAGG - Intergenic
1013130842 6:107231072-107231094 AATTCAGGAATGGCTAAACTGGG + Intronic
1013327101 6:109057181-109057203 AATTCAGGAATGGCTTAGCTGGG - Intronic
1014278669 6:119416949-119416971 AGGTCAGGAATAGCTTTCCTGGG + Intergenic
1014763233 6:125381385-125381407 AACTCAGGCATAACTTAGCTGGG + Intergenic
1014842339 6:126235331-126235353 AACTCAGCAATACCATTACTGGG + Intergenic
1017194297 6:151683601-151683623 AACTCAGGACTAGATTGAATTGG + Intronic
1018824435 6:167398574-167398596 ACCTCTGGGATAGCTGGACTGGG + Intergenic
1020499516 7:8898789-8898811 AACTCAGCAATTTCTTTACTGGG - Intergenic
1021187957 7:17587298-17587320 AAGTTAGGAATAGCTGGAATGGG + Intergenic
1022274986 7:28846408-28846430 AATTCAGGAAGGGCTTGGCTGGG - Intergenic
1022898674 7:34779857-34779879 AATTCAGGAACAGCTTGGCTAGG + Intronic
1022921634 7:35021984-35022006 AACTCAGTATTTGCTTTACTGGG - Intronic
1023459511 7:40379795-40379817 AGCTCAGGAATAACTTGAGAAGG - Intronic
1024839948 7:53574478-53574500 AAATCAGGAATGGCTTCCCTGGG - Intergenic
1024944347 7:54793842-54793864 AACTCAGTAATACCATTACTGGG + Intergenic
1030417319 7:109262017-109262039 AATTCAGGAAGGGCTTGCCTGGG - Intergenic
1031090509 7:117348397-117348419 AAGTCAGGAATGGCTTCCCTGGG + Intergenic
1032729626 7:134626417-134626439 AACTCAAGAAAAGTTTGTCTTGG + Intergenic
1032893040 7:136220333-136220355 AATTCAGGAGCAGCTTGACTGGG - Intergenic
1033661557 7:143406478-143406500 AACTCAGGGAAACATTGACTTGG - Intronic
1034247962 7:149663283-149663305 AAGTCAGGAATGGCTTCCCTGGG + Intergenic
1034321568 7:150188469-150188491 TACTCAGGAATAGAATTACTGGG + Intergenic
1034771184 7:153778813-153778835 TACTCAGGAATAGAATTACTGGG - Intergenic
1039569630 8:38576435-38576457 GACTCGAGAATAGATTGACTCGG + Intergenic
1041085241 8:54250481-54250503 AATTCACTAATTGCTTGACTGGG + Intergenic
1043505207 8:80895668-80895690 AATTCAGGCATAGCTTACCTGGG - Intergenic
1043678849 8:82996590-82996612 AAGTCAGGAATGGCTTCTCTGGG - Intergenic
1043929914 8:86078931-86078953 AAGTCAGTGATAGCTTGATTGGG - Intronic
1044124424 8:88439238-88439260 AATTCAAAAATAGCTTGAATTGG + Intergenic
1044522871 8:93219790-93219812 AACTCATGCCTAACTTGACTGGG + Intergenic
1044872461 8:96632775-96632797 AACTTACGAAGAGCTTTACTTGG + Intergenic
1045035996 8:98176844-98176866 AATTCAGGGACAGCTTGGCTGGG - Intergenic
1045338422 8:101230244-101230266 AACTCAGAAATAGGGTGTCTGGG + Intergenic
1045341661 8:101260432-101260454 AACACAAGAACAGCCTGACTGGG + Intergenic
1045736556 8:105302690-105302712 AACTCAGCAATCCCATGACTGGG + Intronic
1046016074 8:108606896-108606918 AACTCAGGAATAGCTTGACTGGG + Intronic
1047178574 8:122566002-122566024 AATTCAGGAAGAGCTTAGCTTGG + Intergenic
1047377706 8:124318282-124318304 AGATCAGGAATAGCTTAAATGGG - Intronic
1048551395 8:135436738-135436760 TACTCAGGAATGGCATGACCCGG + Intergenic
1051273109 9:15374367-15374389 AAGCCAGGAATGGCTTCACTAGG - Intergenic
1055187199 9:73471190-73471212 AAGTCAGGAATGGCTTCCCTTGG + Intergenic
1056238955 9:84624270-84624292 AACTCATAAATAGGTTAACTTGG + Intergenic
1057884370 9:98818841-98818863 AATTTAGGAGTAGCTTAACTGGG + Intronic
1058378538 9:104353312-104353334 AACCCAGGAATGGCTTAGCTAGG - Intergenic
1060127245 9:121059946-121059968 AATTCAGGAATGGCTTAGCTAGG - Intergenic
1187446326 X:19364312-19364334 AGCTCAGGCATAGCATGCCTTGG + Intronic
1189153835 X:38734787-38734809 AATTCAGGGAAGGCTTGACTAGG - Intergenic
1189368698 X:40410601-40410623 AACCCAGGAGCAGATTGACTGGG - Intergenic
1189511808 X:41670002-41670024 AAGTCAGGATTAGGATGACTGGG + Intronic
1189571464 X:42302399-42302421 AATTCAGGAATTGCTTAGCTTGG + Intergenic
1190953509 X:55169613-55169635 AACACAGGAATCTCTTGCCTAGG + Intronic
1191820378 X:65300014-65300036 AACTCAGGAATGACTTCTCTGGG - Intergenic
1194089541 X:89567759-89567781 AACTCAGGAATGGGGTGAGTTGG - Intergenic
1194960265 X:100227092-100227114 AAGCCAGGAAAAACTTGACTTGG - Intergenic
1195734148 X:107996049-107996071 AAGTCAGGAATGGCTTCCCTGGG - Intergenic
1196112246 X:111959403-111959425 AACTAAGAAATAGCTAGAATAGG + Intronic
1197083446 X:122445985-122446007 AAGTCAGGAATGGCTTCCCTGGG - Intergenic
1198943357 X:141982725-141982747 AAGTCAGGAATGGCTTCCCTGGG + Intergenic
1200442198 Y:3223813-3223835 AACTCAGGAATGGGGTGAGTTGG - Intergenic