ID: 1046016634

View in Genome Browser
Species Human (GRCh38)
Location 8:108613302-108613324
Sequence GAGTGGCTTGGGGGCAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 394}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046016634_1046016641 -4 Left 1046016634 8:108613302-108613324 CCAGGGCTGCCCCCAAGCCACTC 0: 1
1: 0
2: 4
3: 37
4: 394
Right 1046016641 8:108613321-108613343 ACTCACCCTGCCAAACCTCTGGG No data
1046016634_1046016640 -5 Left 1046016634 8:108613302-108613324 CCAGGGCTGCCCCCAAGCCACTC 0: 1
1: 0
2: 4
3: 37
4: 394
Right 1046016640 8:108613320-108613342 CACTCACCCTGCCAAACCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046016634 Original CRISPR GAGTGGCTTGGGGGCAGCCC TGG (reversed) Intronic
900089642 1:914306-914328 GAGTGGCCTGGGTGGGGCCCGGG - Intergenic
900344691 1:2205156-2205178 GCGGGGCGTGGGGGGAGCCCGGG - Intronic
900584196 1:3424677-3424699 GGAGGGCTTGGGGGCTGCCCTGG - Intronic
900622140 1:3592362-3592384 GAGTGTCTGGGGGGCTGCCTGGG - Intronic
901526412 1:9825501-9825523 GTGTGGCTTGGAGCCTGCCCGGG - Intergenic
902508827 1:16954664-16954686 GAGCGGGTTGGGAGCAGCCCGGG + Intronic
902651403 1:17839955-17839977 GGGTGGCTTGAGGACAGGCCTGG + Intergenic
902808524 1:18875357-18875379 GAGTGGCCAGGCCGCAGCCCTGG - Intronic
903128459 1:21263157-21263179 GAATGGCGGAGGGGCAGCCCAGG - Intronic
903575561 1:24337651-24337673 GGATGGCTTTGGGGGAGCCCAGG - Exonic
903964009 1:27074708-27074730 GAGGGACTTGGGGGCTGGCCTGG + Intergenic
904586017 1:31581071-31581093 GAGTGGCTCGTGGGAAGGCCGGG + Intronic
904618252 1:31761268-31761290 GAGTAGCTTGGGGGCAGGGAAGG - Intronic
905449440 1:38047086-38047108 GAGTGGCGCGGGGGTGGCCCTGG + Intergenic
906298968 1:44667813-44667835 GAGGGGCTTCTGGGCATCCCTGG - Intronic
906476416 1:46172204-46172226 CAGTGCCTGGGGAGCAGCCCAGG - Intronic
907442166 1:54485837-54485859 CAGAGGCTCGGGGGCAGCCACGG - Intergenic
911774175 1:101786822-101786844 GAGAGGCTGGTGGTCAGCCCTGG + Intergenic
912801588 1:112722933-112722955 GAGGGGCTGGAGGCCAGCCCGGG + Intronic
913270275 1:117086523-117086545 GTGAGGCTGGGGGGCAGCCAGGG + Intronic
914200481 1:145480380-145480402 CAGTGGCTTTCAGGCAGCCCAGG - Intergenic
915221490 1:154378686-154378708 GAGAGGCTGGTGGTCAGCCCTGG + Intergenic
915919641 1:159964897-159964919 GAGTGGCTTGAGGGAAGCCCTGG + Intergenic
918242584 1:182633752-182633774 GTTGGGGTTGGGGGCAGCCCAGG - Intergenic
919570697 1:199243580-199243602 GAGTGGCATGGCTGCAGCACAGG + Intergenic
919823955 1:201490662-201490684 CTGTGGCTTGGGGTCAGCCTAGG - Intronic
919973735 1:202597586-202597608 GAGTAGGTTGGGGTCAGCCAAGG + Intronic
920353760 1:205355233-205355255 GAGTGGTTTGGCTGGAGCCCAGG - Intronic
921698947 1:218245344-218245366 GAGTACCTTGGTGGCAGCCCCGG - Intergenic
922124716 1:222711687-222711709 GAGGGGATGGGGGGGAGCCCAGG - Intronic
922467523 1:225854305-225854327 AAGGGGCTGGGGGCCAGCCCAGG + Intronic
922606246 1:226891584-226891606 GGGTGGAGTGGGGGAAGCCCTGG + Intronic
923010487 1:230084135-230084157 GAGTGTCTTGAGGCCAGCACAGG + Intronic
923086401 1:230706315-230706337 GAGTGGCCTGGGGGGGGCCAAGG - Intronic
923200846 1:231709959-231709981 GAGTGGCTAGGAGGCTGCCTGGG + Intronic
924515230 1:244760330-244760352 GAGGGTCTGGGAGGCAGCCCGGG - Intergenic
1062935489 10:1382965-1382987 CAGTGGCCTGGGGCCGGCCCTGG + Intronic
1063249920 10:4263623-4263645 GGGTGGGTTGGGGGCAGTCATGG - Intergenic
1063313221 10:4976110-4976132 GAGTGGCCTGGGGTCAGCATGGG + Intronic
1063314735 10:4991632-4991654 GAGTGGCCTGGGGTCAGCATGGG - Intronic
1064756674 10:18577819-18577841 GAGTGGTTTGGCGGGAGCCAGGG - Intronic
1066259506 10:33715468-33715490 GAGTGGCGAGGCGGCAGCCCTGG + Intergenic
1066630105 10:37450891-37450913 TAATGGCTTGGGAGCAGCTCTGG + Intergenic
1067696219 10:48537443-48537465 GATGGGCTTGGGGGCAGAGCTGG - Intronic
1070215234 10:74371914-74371936 GAGAGGCTGGTGGTCAGCCCTGG - Intronic
1072726820 10:97819419-97819441 GTGTGGCTTGGAGGCAGGGCTGG - Intergenic
1072918889 10:99558865-99558887 GCCTGGCTTGAGTGCAGCCCAGG + Intergenic
1073682146 10:105716248-105716270 GATGGTGTTGGGGGCAGCCCAGG - Intergenic
1074113411 10:110438248-110438270 GAGTAGCTTGGGGCCAGCCTGGG - Intergenic
1074270869 10:111952189-111952211 GAGTTCCCTGGGGGGAGCCCTGG - Intergenic
1075209802 10:120481335-120481357 GAGGGGCTTCAGGGCAGCCCAGG + Intronic
1075394028 10:122113664-122113686 GGGTCGCGTGGGGGCATCCCCGG + Intronic
1075967907 10:126628721-126628743 GAGTGGCTGGGGAGACGCCCAGG - Intronic
1077200405 11:1304156-1304178 GAGTGGCTGCTGAGCAGCCCGGG - Intronic
1077218549 11:1405130-1405152 GAGGGGGTTGGGAGCGGCCCGGG + Intronic
1077280898 11:1745022-1745044 GAGAGGCTTTGGGGCATACCTGG - Intronic
1077300286 11:1843553-1843575 GAGTGGGGTGGGGGCAGAGCAGG + Intergenic
1077316460 11:1921421-1921443 GAGGGGCTGGTGGGCAGCCTGGG + Intronic
1077332086 11:1988246-1988268 GGGGGGCTGTGGGGCAGCCCAGG - Intergenic
1077368815 11:2172122-2172144 GAGGGGCTTTCTGGCAGCCCAGG + Intergenic
1077378461 11:2216393-2216415 CAGGGGCCTGGGAGCAGCCCTGG - Intergenic
1077408977 11:2394814-2394836 GAGCGGCTTGTGTGGAGCCCTGG - Intronic
1078015061 11:7606152-7606174 TACTGGCTTGGAAGCAGCCCTGG + Intronic
1078363840 11:10691035-10691057 GAGCGGCTGAGGGGCAGTCCAGG + Intronic
1078860875 11:15245151-15245173 GAGAAGCTTGAGGTCAGCCCAGG + Intronic
1078901946 11:15650294-15650316 GTGGGGCTTGGGGGCCGCCCTGG + Intergenic
1078920481 11:15826100-15826122 GTGTTGCCTGGGGCCAGCCCTGG - Intergenic
1079418211 11:20260591-20260613 GAGTGGCTTGGAGGCAGTGGTGG - Intergenic
1079650480 11:22922341-22922363 CAGGGGCTTGAGGGCAGCCTGGG - Intergenic
1082000418 11:47391064-47391086 TAGGGGTTGGGGGGCAGCCCAGG + Intergenic
1083281953 11:61632390-61632412 GAGAGGCTGGGAGGCAGCCCAGG + Intergenic
1083452380 11:62754487-62754509 GAGTGGCTTGCTGTCAGCTCGGG - Intergenic
1083721821 11:64607238-64607260 GGGCGTCTTGGGGGCAGCCGGGG + Exonic
1084065974 11:66704719-66704741 GCGGGCCTTGGAGGCAGCCCTGG - Exonic
1084066790 11:66708877-66708899 GGGTGGCCTGTGGGCAGCCACGG + Intronic
1084419461 11:69053102-69053124 GAGGGGCTTGTGAGCAGGCCAGG + Intronic
1085509964 11:77083201-77083223 AAGTGGCTTGGGTGCAGAGCAGG + Intronic
1085784519 11:79438667-79438689 GAGGGGCTTTGGGGCTCCCCAGG + Intronic
1087061790 11:93986134-93986156 GAGTGGCATGGAGGCAGGACAGG - Intergenic
1088836194 11:113579636-113579658 GAGTGTGTTCGAGGCAGCCCCGG - Intergenic
1089124334 11:116165883-116165905 GAGTGGGATGGGGGCTACCCAGG + Intergenic
1089757075 11:120695107-120695129 GAGAGGGCTGGGGGCATCCCTGG - Intronic
1090022224 11:123138038-123138060 GAGTCGCCAGGAGGCAGCCCCGG - Intronic
1090848075 11:130546888-130546910 GGGCGGCTGGGTGGCAGCCCTGG - Intergenic
1202815067 11_KI270721v1_random:43422-43444 GGGGGGCTGTGGGGCAGCCCAGG - Intergenic
1091918437 12:4285847-4285869 GAGTGGTCCTGGGGCAGCCCTGG + Intronic
1092014619 12:5148297-5148319 GAGTGACATGTGGGCATCCCTGG - Intergenic
1094494728 12:30982241-30982263 GGGTGTCTTGGGGGCAGGACGGG - Intronic
1096071588 12:48778373-48778395 CAGTGGCTTGGGGACAGACAGGG - Intronic
1096445000 12:51681496-51681518 AAGGGGTTTGGGGGAAGCCCTGG + Intronic
1096674399 12:53218824-53218846 GAGGGGCTTGGGGGCACGCTGGG - Intronic
1098141267 12:67452393-67452415 GAGTGGCTCTGTGGCAGCTCAGG + Intergenic
1098249410 12:68553481-68553503 GAGAGGCTGGTGGTCAGCCCTGG + Intergenic
1099921165 12:88958797-88958819 GGGAAACTTGGGGGCAGCCCAGG + Intergenic
1102429087 12:112867702-112867724 CAGTGGGTTGGGGGGAGCCAAGG + Intronic
1103933356 12:124462360-124462382 GAGGGGCTTGGGTGCAGGACTGG - Intronic
1104678003 12:130728935-130728957 GAGCTGCTCGGTGGCAGCCCCGG - Intergenic
1104807255 12:131597553-131597575 GAGGGGCATGGGGGCAGCCAGGG + Intergenic
1104885312 12:132104063-132104085 CAGTGGCCTGGGGCCTGCCCCGG + Exonic
1104892053 12:132144776-132144798 GAACGGGTTGGGGGCAGCCTAGG + Intronic
1106410139 13:29505813-29505835 GATGGGGGTGGGGGCAGCCCTGG + Exonic
1106412303 13:29519085-29519107 GAGAGGATTGAGGGCTGCCCTGG - Intronic
1106435747 13:29721657-29721679 GAGGGGCTTGGGAGAAGCCTGGG + Intergenic
1107508632 13:41060447-41060469 GAGGGGCGGGGGAGCAGCCCAGG + Intronic
1109741554 13:66561290-66561312 GAGTGGGTGGGGGGAAGCCCAGG - Intronic
1109792417 13:67267302-67267324 GAGAGGCTGGCGGTCAGCCCTGG + Intergenic
1111926129 13:94464868-94464890 CAGGGGCTTGGGGCCAGCCGGGG - Intronic
1113567468 13:111327421-111327443 CAGTGGCTTGGGTGCAGCCTTGG + Intronic
1113639841 13:111949464-111949486 GGGTGGCATGGGGACTGCCCTGG - Intergenic
1113695557 13:112343151-112343173 CAGCGTCTTGGGGGCAGACCCGG - Intergenic
1113782815 13:112986464-112986486 GGGAGGTTTGGGGGAAGCCCAGG - Intronic
1113878655 13:113609892-113609914 GAGTGGCGTGCTGGCAGCACAGG - Intronic
1114367517 14:22046172-22046194 GAGTGGAGAGGGGGCAGCCATGG + Intergenic
1118436023 14:65771458-65771480 GAGTCACTTGGGAGCAGCCCAGG + Intergenic
1118445034 14:65843041-65843063 GAATGGTATGGGGCCAGCCCAGG + Intergenic
1119474205 14:74917877-74917899 GAGCGTCTTGGCTGCAGCCCTGG + Intronic
1119672754 14:76531907-76531929 GAGGGGCAAGGGGGCAGGCCCGG - Intergenic
1119686352 14:76635261-76635283 GAGAGGCTGGTGGTCAGCCCTGG + Intergenic
1121417537 14:93789230-93789252 GAGAGGCTTGGGGGAAGCGCAGG - Intergenic
1121541020 14:94726667-94726689 GAGAGGCTGGTGGTCAGCCCTGG - Intergenic
1121544042 14:94750699-94750721 GGAGGGATTGGGGGCAGCCCTGG - Intergenic
1122118994 14:99541925-99541947 GAGGGGCTGGGAGGCAGACCTGG - Intronic
1122292428 14:100686932-100686954 AAGGGGCCTGGGGGCTGCCCAGG + Intergenic
1122790756 14:104183222-104183244 CACTGTCTTGGGGCCAGCCCAGG + Intergenic
1122889906 14:104727436-104727458 GAGAGGCTTGGAAGCAGCCAGGG - Intronic
1122971273 14:105153216-105153238 GTGTGGCTTGAGGGCGGCTCAGG - Intronic
1125313604 15:38407599-38407621 GAATGGTTTGGGGCCAGCCTGGG - Intergenic
1125768392 15:42149905-42149927 GAGAGCCTTGGGCCCAGCCCAGG + Intronic
1126098539 15:45106078-45106100 GAGTCGTGTGAGGGCAGCCCAGG + Intronic
1126758626 15:51948839-51948861 TACTGGCTTGGGGGAACCCCTGG + Intronic
1126861351 15:52885965-52885987 GAGAGGCTGGTGGTCAGCCCTGG - Intergenic
1127822152 15:62667662-62667684 CAGTGACTTGATGGCAGCCCTGG + Intronic
1127960260 15:63885279-63885301 CACTGGCTCTGGGGCAGCCCTGG - Intergenic
1128209839 15:65889487-65889509 GAGTGCTTTGGGTGCAGCCGTGG + Exonic
1128731422 15:70024008-70024030 GAGCCGCTGAGGGGCAGCCCCGG - Intergenic
1128983635 15:72203494-72203516 GAGTGGCCTGGGCCCAGCCTGGG - Intronic
1129167006 15:73784432-73784454 GATTGGGTGGGGGCCAGCCCTGG + Intergenic
1129305182 15:74655602-74655624 AAGTGGCTTGGTGGCTGGCCCGG - Intronic
1129331921 15:74832241-74832263 CCCTGGCCTGGGGGCAGCCCAGG - Intergenic
1129623911 15:77176725-77176747 TATAGGCTTGAGGGCAGCCCAGG - Intronic
1129887771 15:79050509-79050531 GAGGTGCTTTGGGGCTGCCCAGG - Intronic
1132691514 16:1183718-1183740 GTGAGGCTGGGGGGCGGCCCTGG + Intronic
1132980512 16:2736680-2736702 CAGTGACTGGGGGGCATCCCGGG + Intergenic
1133056549 16:3148236-3148258 CTGTGGCTTAAGGGCAGCCCAGG - Intronic
1133209270 16:4254032-4254054 GCGTGGCTTGGGGGCGGGCCAGG - Intergenic
1133427884 16:5708806-5708828 GAGGGGCTTGGGAGCTGCCATGG + Intergenic
1134612581 16:15621744-15621766 GAGTGATTTGCTGGCAGCCCCGG + Exonic
1137683160 16:50368638-50368660 CAGTGGCTCCGGGGCGGCCCGGG - Intronic
1137867677 16:51917589-51917611 GAGTGGCTCAGGGGCAGGACAGG + Intergenic
1138538845 16:57676046-57676068 AAGTGGCTTGGGGGCCGTCCAGG - Intronic
1140319981 16:73941123-73941145 GAGAGGCTGGTGGTCAGCCCTGG + Intergenic
1141342102 16:83212811-83212833 AAGAGGCTTGGGGGAAGCCTGGG + Intronic
1142007577 16:87697007-87697029 GTGTGGATGGAGGGCAGCCCGGG + Exonic
1142130295 16:88429004-88429026 GAGTGGCAGGGGGGCAGCCAAGG + Exonic
1142200406 16:88758370-88758392 GCCTGGCCTGGGGGCAACCCTGG + Intronic
1142967036 17:3588163-3588185 GAGTGGCTGGGGCACAGCCAGGG - Intronic
1143029395 17:3959512-3959534 GTGGAGCCTGGGGGCAGCCCAGG - Intronic
1143660155 17:8319565-8319587 CAGGTGTTTGGGGGCAGCCCTGG - Exonic
1145246657 17:21274040-21274062 CAGTGGCTTGGGGGTAGTGCAGG - Intergenic
1146681474 17:34811322-34811344 GAGGGGCTGGGGAGGAGCCCTGG + Intergenic
1146804819 17:35856707-35856729 GAGTGGCCTGGGAGCTGCCAGGG - Intronic
1147161597 17:38572232-38572254 GAGTGGCTTAGCCCCAGCCCGGG - Intronic
1147263843 17:39223724-39223746 CAGGGGCTTGGGGGCCTCCCAGG - Intronic
1148350334 17:46937039-46937061 GAGTGACTTGGGGTCTGCCCCGG + Intronic
1148561021 17:48606176-48606198 GAGAGGCTCGGAGGAAGCCCCGG + Intergenic
1148708683 17:49660056-49660078 AAGTGGTATGGGTGCAGCCCAGG + Intronic
1149097001 17:52855260-52855282 TAGTGGCCTGGTGGCAGCCCTGG - Intergenic
1149454493 17:56776980-56777002 GAGTGGGTTTGGGGCAGAGCAGG - Intergenic
1149515844 17:57280321-57280343 AAGTGGCTTGTGGGTACCCCAGG + Intronic
1149564580 17:57631898-57631920 GACTGGAGCGGGGGCAGCCCAGG - Intronic
1151496903 17:74463335-74463357 GAGTGGATGGGGAACAGCCCAGG + Intergenic
1151499229 17:74478236-74478258 GAGTGGCTTGGGGCCCCTCCTGG + Intronic
1151681470 17:75624970-75624992 GAGGGGCTTGGAGGTCGCCCAGG - Intergenic
1152039103 17:77891799-77891821 GAGTGGCTCCTGGGCAGCCATGG + Intergenic
1152103121 17:78314290-78314312 GAGGGAGCTGGGGGCAGCCCGGG + Intergenic
1152261088 17:79267679-79267701 GAGTGACATGGGGCCAGGCCTGG - Intronic
1152523714 17:80875661-80875683 GAGGGGCTTGGTGGAAGACCCGG - Intronic
1152523912 17:80876583-80876605 GAGGGGCTTGGTGGAAGACCCGG - Intronic
1152523934 17:80876679-80876701 GAGGGGCTTGGTGGAAGACCCGG - Intronic
1152655680 17:81518216-81518238 GGGTGGCATGGGGGCATGCCAGG - Intronic
1152735485 17:81995044-81995066 GGGAGGTTTCGGGGCAGCCCGGG - Intronic
1152751169 17:82063081-82063103 GGGAGGCTGGGAGGCAGCCCGGG + Intronic
1152841606 17:82572420-82572442 GTGTCTCTTGGGGGTAGCCCCGG - Intronic
1156341240 18:36212336-36212358 GAGTGGGTGAGGGGCAGCCACGG + Intronic
1157572377 18:48721523-48721545 GTGTGTCTGGTGGGCAGCCCAGG + Intronic
1157591497 18:48838903-48838925 GAGGGGCTGGTGGGCAGGCCCGG - Intronic
1157796726 18:50581697-50581719 GGGTGGCTTGGGAGCTGCTCTGG + Intronic
1158534199 18:58292499-58292521 GACTAGGGTGGGGGCAGCCCAGG - Intronic
1158899586 18:61950218-61950240 GACAGGCTTTGGGGCTGCCCAGG - Intergenic
1158960682 18:62585378-62585400 GAGTGTCTTGGGGGCAGCAGGGG - Intronic
1160125005 18:76163686-76163708 GTGTGGCTTGAGCACAGCCCCGG + Intergenic
1160356382 18:78230786-78230808 AAGTGCCTTGTGTGCAGCCCTGG - Intergenic
1160441393 18:78895450-78895472 GTGTGGCTTGGGTGCACTCCTGG - Intergenic
1160513514 18:79465863-79465885 CAGTGCTCTGGGGGCAGCCCAGG + Intronic
1160517874 18:79488462-79488484 GAGTGGCCAGGGGGCAGCCACGG - Intronic
1160558626 18:79742080-79742102 GAGAGGCCTGGGGGCAGCAGAGG + Intronic
1160811863 19:1016273-1016295 GTGTGGAAGGGGGGCAGCCCCGG + Intronic
1160865100 19:1252859-1252881 CAGTGGCGTGGGGGCAGAGCCGG + Intronic
1160982495 19:1822793-1822815 GAGAGCCTTAGGGCCAGCCCCGG - Intronic
1161015559 19:1981112-1981134 CAGGGGCCTGGGGGCGGCCCTGG + Exonic
1161055750 19:2189947-2189969 GAGTGGTGTGGGGGCTGCCGAGG + Intronic
1161120196 19:2521450-2521472 GAGTGGGTTGGGTGGAGGCCAGG + Intronic
1161234926 19:3193059-3193081 GGGTGGGTTGGGGGAAGCCCTGG + Intronic
1161738468 19:6005952-6005974 GAGTAGCCTGTGTGCAGCCCTGG - Intronic
1161794083 19:6376411-6376433 GAGAGGCCTGGGGACAGCCAAGG + Intronic
1162423057 19:10577130-10577152 GAGTAGTGTGGGGGCTGCCCAGG - Intronic
1162477283 19:10908180-10908202 GAGTGGCAGGGGGGCTGCCGGGG - Intronic
1163004450 19:14388822-14388844 CAGAGGCTTGAGGGCAGCGCAGG + Intronic
1163063011 19:14773912-14773934 CAGAGGCTTGAGGGCAGCGCAGG - Intronic
1163234429 19:16022574-16022596 GGGAGGTTTGGGGGCAGGCCTGG + Intergenic
1163696118 19:18764391-18764413 GAGTGGATGGGGGTCAGGCCAGG + Intronic
1163748818 19:19063629-19063651 GCGTAGCTTGGGGGGAGACCGGG - Intergenic
1163799784 19:19357319-19357341 CATGGGCCTGGGGGCAGCCCTGG - Exonic
1164287151 19:23827541-23827563 GAGAGGCTGGTGGTCAGCCCTGG - Exonic
1164797689 19:31047400-31047422 GTGTGGCTTTGGTGTAGCCCCGG + Intergenic
1164844379 19:31419413-31419435 GAGTGGGCTGGGGGAAGCCCAGG - Intergenic
1168209609 19:54881064-54881086 CCGTGGCTTGGGGGCAGCAGGGG + Intronic
1168351753 19:55680028-55680050 GAGTGGCCTGTGGGCAGGGCTGG + Intronic
1168703578 19:58455492-58455514 GGGTGCCTGGGAGGCAGCCCAGG + Exonic
926125401 2:10268607-10268629 GTGTGGCTCAGGGGCACCCCTGG + Intergenic
926698083 2:15784645-15784667 GAGTGCGATGGGGGCAGCCTCGG + Intergenic
927478073 2:23429241-23429263 GAGTTGCTTTTGTGCAGCCCAGG + Intronic
927875148 2:26650259-26650281 GAGGGGGCTTGGGGCAGCCCAGG + Intergenic
928378595 2:30799357-30799379 GAGTGGCTCAGGGACAGCACTGG - Intronic
929007653 2:37411469-37411491 GTGTGGCTTGGGGTCAGGACAGG - Intergenic
930089858 2:47523864-47523886 CAGTGGGGTGGGGCCAGCCCTGG + Intronic
931077070 2:58727209-58727231 TGGTGGCTTGGGGGTAGCTCAGG + Intergenic
931423169 2:62146756-62146778 GAGAGGCTGGTGGTCAGCCCTGG - Intronic
931994584 2:67827868-67827890 GAATGGCTTGGGTGCAGGGCCGG + Intergenic
932579519 2:72984420-72984442 GTGTGGCCTGGAGGCAGCCAAGG - Intronic
932694602 2:73944835-73944857 GAGATGGTTGGGAGCAGCCCTGG - Intronic
934717010 2:96550221-96550243 GACGAGCTGGGGGGCAGCCCAGG + Exonic
935057082 2:99577057-99577079 GGAAGGCTTGAGGGCAGCCCAGG - Intronic
935448307 2:103180161-103180183 GAGTGGGGAGGGGGCAGCCTCGG - Intergenic
935650871 2:105381014-105381036 AAGTGGCCTGGAGGGAGCCCTGG + Intronic
937041238 2:118822292-118822314 GCGTGGATTTGGGGCAGCCGAGG - Intergenic
937355706 2:121196838-121196860 GAGTGCCTTGAGAGCAGGCCTGG - Intergenic
937987830 2:127646459-127646481 AAGTGGCTTGCCGGCAGTCCAGG + Intronic
940883251 2:158968331-158968353 GAGGGGCCTAGGCGCAGCCCCGG + Intergenic
942250459 2:174043387-174043409 GAGGGGCTGGTGGTCAGCCCTGG - Intergenic
942277687 2:174334853-174334875 GATTGGCTGCGGGGCAGCTCCGG + Intergenic
942541695 2:177021755-177021777 GAGTTTCTCTGGGGCAGCCCCGG - Intergenic
945258257 2:207820410-207820432 GAGTGGGTGAGGGTCAGCCCAGG + Intergenic
945300159 2:208208493-208208515 GAGAGGCTGGTGGTCAGCCCTGG - Intergenic
948056484 2:235012579-235012601 GCGAGGCTTGGGGTCAGGCCAGG - Intronic
948496360 2:238352352-238352374 GAGAGGTCTGGGGTCAGCCCTGG + Intronic
948565761 2:238885034-238885056 GAGCGGGTGGGGGTCAGCCCTGG + Intronic
948819137 2:240529731-240529753 GAGGGGCAAGGGGGCAGCCAGGG + Intronic
948834391 2:240618956-240618978 GTGTGGAGTGGGGACAGCCCGGG - Exonic
948881170 2:240857904-240857926 GAGTGGCCTGGTGGCAGCTGAGG + Intergenic
949064884 2:241983998-241984020 GAGATGCTTTGGGGCAGCCTTGG + Intergenic
1168763910 20:368907-368929 GAGGTGTTTGGGGGAAGCCCAGG - Intronic
1172949057 20:38710614-38710636 GAGGGGCTTGGGTGCTGTCCAGG + Intergenic
1173502699 20:43565586-43565608 GAGAGGCTGGGCTGCAGCCCAGG + Intronic
1174118807 20:48247087-48247109 GAGTGTGTTGGTGGCAGCCCAGG + Intergenic
1174462421 20:50692001-50692023 AAGGGGCTTGGGGGAAACCCAGG - Intergenic
1175423997 20:58852997-58853019 GAGGGGCTGGGGGGCAGCCTGGG + Exonic
1175758725 20:61546864-61546886 GATTGGCTGGGGGGCTGCACGGG + Intronic
1175844443 20:62051235-62051257 GACTGGCTGGGGCGCAGGCCGGG - Intronic
1176035710 20:63035509-63035531 GGGTGGCCTGAGGGCAGCTCCGG - Intergenic
1176037695 20:63048390-63048412 GTGTGGGGTGTGGGCAGCCCAGG + Intergenic
1176122097 20:63458554-63458576 GGGAGACTTGGGGGCTGCCCGGG - Intronic
1176146944 20:63569696-63569718 GGGAGGGTTGGGGGGAGCCCTGG - Intronic
1176214197 20:63940574-63940596 GAGGTGCCTGGGGGCAGCCGGGG - Exonic
1179182946 21:39061175-39061197 CTGTGCCTTGGGGACAGCCCAGG - Intergenic
1179725913 21:43341171-43341193 GAGGGGCTTGGCAGGAGCCCTGG - Intergenic
1179935677 21:44602243-44602265 TCGTGGCGTGGGAGCAGCCCAGG - Intronic
1180001727 21:44998216-44998238 GAGTGGTTTGGGGACCCCCCTGG + Intergenic
1180188800 21:46153125-46153147 GTGTGGACTGGGGGCTGCCCAGG - Intronic
1180700421 22:17778476-17778498 GGAGGGCTTGGGGGCAGCTCTGG + Intergenic
1181047534 22:20222732-20222754 GAATGGCTTGGGGTCTGACCTGG + Intergenic
1181325149 22:22039152-22039174 GAATGGGTTGGGGGCTGCACAGG - Intergenic
1181649021 22:24248659-24248681 GCGTGGCTTGGGGGCTGTGCAGG + Intergenic
1181700845 22:24620458-24620480 CAAGGGCTTGGCGGCAGCCCTGG + Exonic
1181764303 22:25080130-25080152 GAGGGTCTTGGGGGCAGATCGGG + Intronic
1182261105 22:29073394-29073416 GACGGGCCTGGGGGTAGCCCGGG - Intronic
1182422572 22:30255831-30255853 GAGTGGCTTGTGGGGAGCAGTGG + Intergenic
1182947358 22:34335846-34335868 GCGTGGCATGGGGGCAGGTCTGG + Intergenic
1183549187 22:38471296-38471318 GACTGCCTGGGAGGCAGCCCTGG - Intronic
1183589278 22:38770411-38770433 GAGGGGCTTGGCTCCAGCCCGGG + Intronic
1184196486 22:42932839-42932861 GGGTGTCCTGGGGGCTGCCCAGG - Intronic
1184656250 22:45943593-45943615 GAGAGGCCCTGGGGCAGCCCCGG - Intronic
1184955578 22:47883903-47883925 GAGTGTCATGGGGGCAGCGAGGG + Intergenic
1185044162 22:48520652-48520674 GAGGGGCTTTGGGGCAGAGCCGG + Intronic
1185049102 22:48544363-48544385 CACTGGCTTGGGGGCAGTTCAGG + Intronic
1185231781 22:49687882-49687904 GAGACGGTTGGGGGCAGGCCAGG - Intergenic
1185337570 22:50277566-50277588 GAGTGGGGTGGGGGCAGGTCTGG - Intronic
1185381139 22:50507953-50507975 GCGGGGCTTGGGGGCTGCCACGG - Intergenic
950624092 3:14231612-14231634 GAGTTGGTTGGGGGCAGGTCAGG - Intergenic
951642130 3:24847900-24847922 AAGTGGCTATGGGGCACCCCTGG - Intergenic
953058934 3:39410881-39410903 GAGAGGCTGGTGGTCAGCCCTGG - Exonic
953115005 3:39984110-39984132 GAGTGGTTGTGGGGCAGGCCAGG + Intronic
953406956 3:42664446-42664468 GGCTGGGTTGGGGGCAGGCCTGG - Exonic
953608041 3:44424601-44424623 GGGTGACCTGGGGCCAGCCCAGG - Intergenic
953880899 3:46690840-46690862 GAGTGCCATGCGGGCATCCCAGG + Intronic
954813092 3:53259996-53260018 TCTTGGCTTGGGTGCAGCCCTGG - Intergenic
959024033 3:101219872-101219894 GAGTGGTTGGGGGGCATCACTGG + Intergenic
959085735 3:101849407-101849429 GAGGGGCTGGGAGGCGGCCCGGG + Intronic
959816771 3:110682772-110682794 GAGAGGCTGGTGGTCAGCCCTGG + Intergenic
961328235 3:126124248-126124270 GAGTAGCCTGGGGAGAGCCCAGG - Intronic
961592029 3:127988353-127988375 GTGTGGGTTGGGTGCAGCCGAGG + Intergenic
963082380 3:141406245-141406267 GAGTAGCTTGGGGGGAGATCGGG + Intronic
964737072 3:159928218-159928240 GAGTGGTGTGTGTGCAGCCCAGG - Intergenic
966439813 3:179931397-179931419 GAGTTGGTTGGGGGCAGACTTGG + Intronic
966815688 3:183887941-183887963 GAGAGGCTGGTGGTCAGCCCTGG - Intergenic
967884516 3:194324034-194324056 GAGTGGTTTGGGGGAGGCCCGGG - Intergenic
968292769 3:197551775-197551797 GAGTGGAATGGGGGAAGCACAGG - Intronic
968402642 4:311899-311921 GAGTGTCTTGGTGGCAGGCTAGG + Intergenic
968761211 4:2443469-2443491 GACTGGCATGGAGGGAGCCCAGG - Intronic
969308518 4:6339171-6339193 CAGCGGCTTGGGGGCAGCAGAGG - Intronic
972497709 4:39649193-39649215 GAGTGGCTGTGGAGCTGCCCTGG + Intergenic
979323291 4:119349552-119349574 GAGTGGCTGGTGGGCCACCCAGG + Intergenic
981660041 4:147156379-147156401 GAGTGGCTTTGCGGCAGCACAGG + Intergenic
985063808 4:186103095-186103117 GAGAGGGTTGGGGGCAAACCAGG - Intergenic
985576429 5:675444-675466 GTGTGGCTGGGGTGCAGCACAGG + Intronic
986050063 5:4081675-4081697 GAGGGTCTTGGGGGCGGTCCTGG + Intergenic
989482824 5:41951793-41951815 GAGAGGCTTGTGGTCAGCCCTGG + Intergenic
991651655 5:68861941-68861963 GAGTCTTTTAGGGGCAGCCCTGG - Intergenic
992590970 5:78295226-78295248 GAAAGTCTTGGGGGCAGACCGGG + Intergenic
995311686 5:110720150-110720172 TAGTGGCTTGGAGACTGCCCAGG - Intronic
995421494 5:111972649-111972671 GTATGGCGTGGGGGCAGCACTGG - Intronic
997426983 5:133809944-133809966 GAATGCCTTGAGGGCAGCCCTGG - Intergenic
997501918 5:134382024-134382046 GGGTGGCTTGAGGCCAGCCTAGG + Intronic
997511861 5:134459717-134459739 GAGTGGTTTGAGGGGAGCTCAGG - Intergenic
997887987 5:137648528-137648550 GAGTGGCTGGGAGACAGCCTCGG + Intronic
999143746 5:149379423-149379445 GAGGGGCGTGGGGGCAGGCCAGG + Intronic
999323697 5:150630311-150630333 GAGTGTTTAGGGAGCAGCCCAGG + Intronic
1001090334 5:168735394-168735416 GAGTGATGTGGGGGCAGCTCAGG + Intronic
1001897486 5:175393988-175394010 GACAGGCTTGGGCTCAGCCCTGG + Intergenic
1002347110 5:178555787-178555809 TAGTGACTCGGGGGCATCCCAGG - Intronic
1002441258 5:179265629-179265651 GAGTTGCCTGGGGTCAGCCGGGG - Intronic
1002523636 5:179804421-179804443 CAGACCCTTGGGGGCAGCCCGGG - Intronic
1005304416 6:24499374-24499396 GAGTGCCTTGATGGCAGCCCAGG + Intronic
1005560939 6:27040141-27040163 GAGTAGGTTGTGTGCAGCCCTGG + Intergenic
1005841629 6:29747991-29748013 GGGAGGCATAGGGGCAGCCCTGG + Intergenic
1005871079 6:29974861-29974883 GAGAGGCATAGGGGCAGCACTGG + Intergenic
1006182814 6:32164199-32164221 AAGGGGCAGGGGGGCAGCCCAGG - Intronic
1006399286 6:33807077-33807099 GAGTGTCTTGGAGGCATCTCTGG - Intergenic
1006450693 6:34104192-34104214 GAGAGAGCTGGGGGCAGCCCAGG + Intronic
1006915552 6:37591587-37591609 GGGAGGCTTGGGGACAGGCCTGG - Intergenic
1007380636 6:41488248-41488270 GAGAGGCTTGGGGCCAGCCCAGG - Intergenic
1007462715 6:42030128-42030150 TAGGGGCTTTGGGGCAGCACTGG - Intronic
1007467762 6:42066721-42066743 GAGACACTTGGTGGCAGCCCAGG + Intronic
1008530595 6:52454457-52454479 GACTGTCTTGGGGGCACGCCTGG - Intronic
1009957055 6:70468468-70468490 GAGTGACATGGAGGCAGGCCAGG - Intronic
1011699768 6:89944702-89944724 GAGTGTGTTGGGGGCAGGCAGGG - Intronic
1011921078 6:92577741-92577763 GAGTGCCCAGGGGGCAGCACAGG + Intergenic
1013666652 6:112356325-112356347 GAGAGGCTGGTGGTCAGCCCTGG + Intergenic
1013667133 6:112360355-112360377 GAGTTGCCTGGGAGCAGCCCAGG - Intergenic
1014638560 6:123879950-123879972 TGGTGTCTTGGGGGAAGCCCAGG + Intronic
1015796363 6:137016087-137016109 CACTGGCTGGGAGGCAGCCCAGG - Intronic
1016939749 6:149474309-149474331 GCGTGGCCCGGGGACAGCCCTGG - Exonic
1017685855 6:156913652-156913674 GAGTGGGATGGGGGCACCACGGG - Intronic
1017685961 6:156914013-156914035 GAGTGGAATGGGGGCACCACGGG - Intronic
1017685978 6:156914066-156914088 GAGTGGAATGGGGGCACCACAGG - Intronic
1017686007 6:156914161-156914183 GAGTGGAATGGGGGCACCACAGG - Intronic
1017686023 6:156914211-156914233 GAGTGGAATGGGGGCACCACGGG - Intronic
1018472595 6:164109878-164109900 AAGTGACCTGTGGGCAGCCCTGG + Intergenic
1018702238 6:166436442-166436464 TAATGCCTTGGGGGCAGTCCTGG + Intronic
1018768887 6:166955771-166955793 GAGTGGGTTGGGGGGAGCCCTGG - Intronic
1018860939 6:167710133-167710155 AGGTGCCCTGGGGGCAGCCCCGG + Intergenic
1018945644 6:168345699-168345721 GGGAAGCTTGGGGGCAGCCGGGG + Intergenic
1019307762 7:344016-344038 CAGTGGCTGGGGGGCGGCCTGGG - Intergenic
1019524449 7:1474456-1474478 GGGTGGTTGGGGGGCAGCACGGG - Intronic
1019711320 7:2519513-2519535 GAGGGGCTTGGGGACGGGCCCGG - Intronic
1019784645 7:2967457-2967479 GACTGGCTAGGGGGAAACCCTGG + Intronic
1021740359 7:23680298-23680320 GAGCGGCGGGGGGGCAGGCCCGG - Intronic
1021892447 7:25199006-25199028 GAGTGGCCTGAGGGCAGAGCTGG + Intergenic
1022525889 7:31037056-31037078 TAGTGGCCAGGAGGCAGCCCTGG + Intergenic
1023833298 7:44052817-44052839 AAGTGGCTTTGGGGGAGGCCTGG + Intronic
1023862434 7:44224652-44224674 GATGGGCTTGGGGCCAGCCTGGG - Intronic
1026129996 7:67612271-67612293 GAGTGGCTTGTGGCCAGCTCTGG + Intergenic
1026524058 7:71139514-71139536 GAGTGGCTTGGGGGCAGGACTGG - Intronic
1026734623 7:72941926-72941948 GAGGGGCTGGGGAGCAGCCCTGG - Exonic
1026784958 7:73296838-73296860 GAGGGGCTGGGGAGCAGCCCTGG - Intergenic
1026837192 7:73647147-73647169 GGGTGGCTGGGAGGAAGCCCTGG + Intergenic
1027109119 7:75423092-75423114 GAGGGGCTGGGGAGCAGCCCTGG + Exonic
1027233211 7:76283536-76283558 GAGTGGCCTGTGGTCAGCCTGGG + Intronic
1028762528 7:94510578-94510600 GCGGTCCTTGGGGGCAGCCCGGG + Intronic
1031026570 7:116686055-116686077 TAGTGGCTGGGGGGCAGTTCAGG - Intronic
1032094824 7:128932763-128932785 GAGAGTATTGGGGTCAGCCCTGG + Intergenic
1032482037 7:132254995-132255017 GGGTGGCCTGGGGGAAGGCCGGG + Intronic
1034468763 7:151245026-151245048 GAGTGGCTTTGAAACAGCCCGGG + Intronic
1034485150 7:151355981-151356003 CAGCTGCTTGGGGGCAGCACTGG + Intronic
1034872928 7:154699723-154699745 GAGTGGCCTTGGAGAAGCCCTGG + Intronic
1034933394 7:155182246-155182268 GAGAGGCTTGTGGGCAGCACAGG + Intergenic
1035004486 7:155644870-155644892 GAGTGCCATGGCGGCCGCCCTGG + Exonic
1037568194 8:20135511-20135533 GAGTAGCTGGGGCGGAGCCCTGG - Intergenic
1037734496 8:21555540-21555562 GCAGGGCTTGGGGCCAGCCCCGG + Intergenic
1037799290 8:22023876-22023898 GAGAGGCTTGGGGGCCTGCCAGG - Intergenic
1037807238 8:22065469-22065491 GAGCGGCTTTGGGATAGCCCTGG + Intronic
1039888321 8:41668182-41668204 GAGTGCCTGAGAGGCAGCCCTGG + Intronic
1040551153 8:48438687-48438709 GAATGGGTTGGGAGTAGCCCCGG + Intergenic
1041017876 8:53609473-53609495 GAGTGGCTTGGGCTCTCCCCAGG - Intergenic
1042965993 8:74352537-74352559 CAGTGGCGAGGGGGAAGCCCAGG + Intronic
1043986972 8:86705398-86705420 GGGTGGGTTGGGGGCAGCGGGGG - Intronic
1045677927 8:104628720-104628742 GAGTGCCATGGGGGCAGGCTTGG - Intronic
1046016634 8:108613302-108613324 GAGTGGCTTGGGGGCAGCCCTGG - Intronic
1047072196 8:121357670-121357692 AAATGGGTTGTGGGCAGCCCTGG - Intergenic
1047127262 8:121976201-121976223 GAGTGGCATGGGGGTGGCACGGG - Intergenic
1049613066 8:143564750-143564772 GAGTGGGGTGGGAGTAGCCCGGG + Intergenic
1049625340 8:143617370-143617392 GAGGGGCATGGGGGCAGCCTGGG - Intronic
1049647445 8:143741969-143741991 GAGTGGCATGGGGGCAGGAATGG - Intergenic
1049799340 8:144510546-144510568 TAGTGGATTGGGGGCAGCTCAGG - Intronic
1051265894 9:15307641-15307663 GTGTGGCCTGAGGGCAGCCTTGG + Intergenic
1051291911 9:15553376-15553398 GAGTGAGTTTGGGGCGGCCCTGG + Intronic
1055447685 9:76399078-76399100 GAGAGGCTGGTGGTCAGCCCTGG - Intergenic
1056635079 9:88324833-88324855 GAGAGGCTGGTGGTCAGCCCTGG - Intergenic
1056848262 9:90058869-90058891 GAGGGACATGAGGGCAGCCCGGG + Intergenic
1056943018 9:90971393-90971415 GAGCAGGTTGGGGACAGCCCAGG + Intergenic
1056950247 9:91035933-91035955 AAGTGGCTTCGGGGCAGCTACGG - Intergenic
1057867097 9:98690344-98690366 TAATGGCTTTGGGGGAGCCCTGG - Intronic
1059023271 9:110598835-110598857 GAGTGCCTGGGGGGCAGGGCAGG - Intergenic
1059450429 9:114368230-114368252 CAGCAGCCTGGGGGCAGCCCTGG - Intronic
1060147172 9:121263076-121263098 GAGTCGAATGGGGGAAGCCCAGG + Intronic
1061918931 9:133771698-133771720 GGGTGGGGTAGGGGCAGCCCAGG - Intronic
1062468170 9:136690691-136690713 GTGTGGCCAGGGGGCAGCCACGG + Intergenic
1062499776 9:136847422-136847444 GCGGGGCTCGGGGGCGGCCCTGG - Exonic
1062617189 9:137403220-137403242 AAATGGGTTGGGGGCACCCCAGG + Intronic
1062622097 9:137427754-137427776 GAGAGGCTTGGGGGCGGGCAGGG + Intronic
1185799360 X:2995791-2995813 GATTGGATTAGGGCCAGCCCTGG + Intergenic
1185872131 X:3673268-3673290 GGGTGGCCTGGGAGAAGCCCCGG + Intronic
1189032617 X:37465771-37465793 GTGTTGCTTGGGGTAAGCCCTGG + Intronic
1189538712 X:41963952-41963974 GAGGGACTTGGGGACAGACCAGG + Intergenic
1189806588 X:44741466-44741488 GAGAGGCTGGTGGTCAGCCCTGG - Intergenic
1190937069 X:55007078-55007100 GAGAGGCTTGGGGACAGCTAGGG - Exonic
1192754395 X:74031544-74031566 GAGAGGCTGGTGGTCAGCCCTGG - Intergenic
1193943364 X:87703829-87703851 GAGAGGCTGGTGGTCAGCCCTGG + Intergenic
1194953840 X:100156369-100156391 GAGAGGCTGGTGGTCAGCCCTGG + Intergenic
1195159101 X:102154418-102154440 GATGGGCTTTGGGGCAGCGCTGG - Intronic
1195992525 X:110696763-110696785 AAGTGGTTTGGGGGAAGGCCTGG + Intronic
1198137013 X:133763175-133763197 GAGAGGCTGGTGGTCAGCCCTGG - Intronic
1198276142 X:135097725-135097747 TAGTGGGCTGGGGGCGGCCCCGG - Intergenic
1199291147 X:146106058-146106080 GGGGGCCTTGGGCGCAGCCCAGG + Intergenic
1200017780 X:153179477-153179499 CAGGGGTCTGGGGGCAGCCCAGG - Intronic
1201453182 Y:14138564-14138586 GAGAAGCTTGGAGTCAGCCCAGG + Intergenic