ID: 1046019993

View in Genome Browser
Species Human (GRCh38)
Location 8:108653293-108653315
Sequence TATATTCTTCAGAGCACAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 187}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046019990_1046019993 15 Left 1046019990 8:108653255-108653277 CCTGAAGCATTGAAGACAGGAAT 0: 1
1: 0
2: 1
3: 34
4: 287
Right 1046019993 8:108653293-108653315 TATATTCTTCAGAGCACAGTGGG 0: 1
1: 0
2: 3
3: 6
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046019993 Original CRISPR TATATTCTTCAGAGCACAGT GGG Intronic
900493317 1:2964064-2964086 TATCTTCTTCAGAGATCAGTGGG - Intergenic
902672490 1:17984452-17984474 TGTATTCTCCAGAAGACAGTGGG + Intergenic
903481517 1:23656973-23656995 TATATGCCTCTCAGCACAGTTGG - Intergenic
903882286 1:26519390-26519412 CTTATTCTTCTTAGCACAGTTGG + Intergenic
905068961 1:35208637-35208659 AATATTCTTCAGACCACAAAGGG + Intergenic
907310016 1:53533903-53533925 TATCTTCTTCACTGCCCAGTAGG + Intronic
907562040 1:55399889-55399911 TTTTTTCTTCAGAGCAGAGCCGG + Intergenic
909611281 1:77554206-77554228 TAGATTTTTCAGTGAACAGTGGG - Intronic
910773027 1:90848977-90848999 CTTATTCTTCAGAGCACTGAAGG + Intergenic
915085647 1:153386835-153386857 TTGATTCTTGAGTGCACAGTTGG - Intergenic
917386015 1:174475243-174475265 TGTAGTCTACAGAGCACACTTGG + Intronic
917738328 1:177940101-177940123 TCTTTTCTTCAGAGCAGAATGGG + Intronic
919145168 1:193625172-193625194 GAAATTTTTCAGAGCAAAGTAGG + Intergenic
920530506 1:206698531-206698553 TCTATTATTCAGATCACTGTAGG + Intronic
922960824 1:229644456-229644478 TGCATTCTTCAGTGCACAGCTGG - Intronic
922996504 1:229966576-229966598 TATAGGCTTCAGTGCACAGAAGG + Intergenic
923483256 1:234404569-234404591 TTTAGTTTTCAGAGGACAGTTGG + Intronic
923704659 1:236334296-236334318 TTTATTCCTCATAGCACAGCAGG + Intergenic
1063280669 10:4626265-4626287 TATCTTTTTCAGAGAAAAGTGGG + Intergenic
1063629528 10:7721026-7721048 TCTCTTCTCCAGAGCACAGAAGG - Intronic
1068144573 10:53051152-53051174 ATTATTCTTCAGAGCAGAGAAGG + Intergenic
1069975934 10:72213321-72213343 TATATTTTTCAGGGCATAATTGG - Exonic
1070526902 10:77303108-77303130 TTTAGTGTTCAGAGCAGAGTAGG - Intronic
1070638489 10:78148355-78148377 TATTTTCTGCAGATCACAGATGG - Intergenic
1071375318 10:84996303-84996325 TAACTCCTTCAGAGCACCGTTGG - Intergenic
1071922148 10:90362573-90362595 TATATTAGTCAGAACACAATAGG - Intergenic
1073527992 10:104204085-104204107 TACATTCTTCACTGCACAGGAGG + Intronic
1075439864 10:122471422-122471444 GATATTTTTCAGAGGACAGAAGG - Intronic
1075488879 10:122849309-122849331 TATATCCTTCACAGCACTGCAGG + Exonic
1077796746 11:5500288-5500310 TATATACTTCAGATCACATAGGG - Intronic
1079344493 11:19640114-19640136 TATATGTTTCAGGGCAAAGTGGG + Intronic
1079496707 11:21052604-21052626 TATTTCCTTCACAGCACAGCTGG - Intronic
1079675490 11:23221186-23221208 TATATTTTTCAAATTACAGTTGG - Intergenic
1079816427 11:25065369-25065391 TATATAATACAGAACACAGTGGG + Intronic
1080176211 11:29365918-29365940 TATTTTAGACAGAGCACAGTAGG - Intergenic
1080756244 11:35202250-35202272 TGTACTCTTTAGAGCAAAGTTGG + Intronic
1082635384 11:55587188-55587210 GATATTCTTGAGAGACCAGTTGG - Intergenic
1083642851 11:64154673-64154695 CATATCCTGCAGAGCACAGCAGG - Intronic
1086510025 11:87546263-87546285 TATTGTGTTCACAGCACAGTGGG - Intergenic
1090476198 11:127023324-127023346 TATATTCTCCAGAGCAAACAAGG + Intergenic
1092404725 12:8211530-8211552 TATATTCCTCAGAGCTGAGGAGG + Intergenic
1094645097 12:32315651-32315673 TATAATTTTCAGAGTACAGATGG + Intronic
1098321179 12:69245218-69245240 TATATGACTGAGAGCACAGTAGG + Intronic
1098466881 12:70797332-70797354 AAAATTCTTGAGAACACAGTTGG - Intronic
1098986649 12:77019508-77019530 TGAGTTCTTCAGAGCACAGTTGG + Intergenic
1099471604 12:83056797-83056819 TAGGGTCTTCAGAGCAAAGTGGG + Intronic
1101096238 12:101344417-101344439 TATATTCCTCACAGAACATTTGG + Intronic
1101250094 12:102924851-102924873 TTTATTGTTCAGGGCACAATAGG - Intronic
1101370296 12:104122870-104122892 TATTTTCTTAAAAGCACAATGGG + Intronic
1102394037 12:112573277-112573299 TATATTCTGCAGGCCACATTTGG + Intronic
1105466976 13:20653103-20653125 TATTTTATTTAGATCACAGTGGG + Intronic
1106784013 13:33089297-33089319 GAGATTCTTCAGAGCCTAGTGGG - Intergenic
1109875422 13:68396778-68396800 TAAATACATCAGAGCATAGTAGG - Intergenic
1110384384 13:74891843-74891865 TATATTCTTAATAGAACAGAAGG - Intergenic
1110965037 13:81684031-81684053 TCTATTCTTCACACCACAGGTGG + Intergenic
1111718437 13:91911100-91911122 TATTTTATTCAGAGAACAGAAGG + Intronic
1112134005 13:96555120-96555142 TGTATTCTGCAGAGTAAAGTGGG + Intronic
1113326404 13:109285910-109285932 GATATTCTTGAGAGCTCAGAAGG + Intergenic
1116655523 14:47648717-47648739 TGTATTCTGCAGAGAACATTGGG - Intronic
1119142429 14:72279490-72279512 TATATATTTCTGAGCAGAGTAGG - Intronic
1121996730 14:98608528-98608550 TCTCCTCCTCAGAGCACAGTGGG + Intergenic
1123409602 15:20047754-20047776 TATTTGCTTCAGAGAACAGGGGG + Intergenic
1123518933 15:21054462-21054484 TATTTGCTTCAGAGAACAGGGGG + Intergenic
1123739177 15:23218647-23218669 TATTTTATTCAGAGAACAGAAGG + Intergenic
1124290395 15:28447603-28447625 TATTTTATTCAGAGAACAGAAGG + Intergenic
1124292842 15:28469945-28469967 TATTTTATTCAGAGAACAGAAGG - Intergenic
1127489661 15:59450379-59450401 TGTCTTCTTAAGAGCACATTTGG + Intronic
1129650351 15:77482621-77482643 TACATTCTTCAGACTAAAGTAGG + Intronic
1129965033 15:79727009-79727031 TATGTTCATCACAGCACTGTTGG - Intergenic
1133609000 16:7415603-7415625 AATATTATTAAGAACACAGTAGG + Intronic
1133991743 16:10712640-10712662 ATTACTCTTCATAGCACAGTGGG - Intergenic
1138968333 16:62113021-62113043 TATATGCTACAGAGTATAGTAGG - Intergenic
1146153892 17:30502783-30502805 TTTATTTTACAGAGCACATTTGG - Intronic
1148050763 17:44769017-44769039 TAAATTTTTCAGAGTGCAGTGGG - Intronic
1148516065 17:48218715-48218737 TAGTTTCATCAGAGCACAGGAGG + Intronic
1149336310 17:55639860-55639882 TTTATTCTTCAGGGGACATTTGG + Intergenic
1153129864 18:1842757-1842779 TATTCTCTTCAGAGGAAAGTTGG + Intergenic
1155564211 18:27115068-27115090 CACATTCTTCACAGCACAGCAGG - Intronic
1156174754 18:34530678-34530700 TATCTTCCTCAAAGCACTGTTGG - Intronic
1157590944 18:48836170-48836192 TGAATGCTCCAGAGCACAGTGGG - Intronic
1158685818 18:59613423-59613445 TATATTCTTCAGAGAAAAACAGG - Intronic
1158808186 18:61000151-61000173 TTTATTCTTCCTACCACAGTGGG + Intergenic
1161503340 19:4629921-4629943 AATATTCTTCCAAGCACAATGGG + Intergenic
1164825855 19:31284448-31284470 GATCTTCTTCCGAGCCCAGTGGG - Intronic
1166878182 19:45910966-45910988 TATATACTTCAGAGCACACTGGG + Intergenic
925956199 2:8968008-8968030 TACTCTCTTCAGAGCTCAGTTGG - Intronic
926471594 2:13266390-13266412 TGCTTTCTTCAGAGAACAGTTGG - Intergenic
926872607 2:17439856-17439878 TATGTTCTTTAGAGGACAGGAGG + Intergenic
928736944 2:34302023-34302045 TATATGATTGACAGCACAGTAGG + Intergenic
933871152 2:86566791-86566813 TATATTTTTCAGAGATCAGGAGG - Intronic
937875903 2:126825101-126825123 TATATTGAGCAGAGCACTGTGGG + Intergenic
939014117 2:136881358-136881380 TTTATTCTTAAAAGCAGAGTTGG - Intronic
939053634 2:137335084-137335106 TATTTTCTTCATAGCAGTGTGGG + Intronic
939360687 2:141168964-141168986 TTTATTCCTAAGAGCAAAGTTGG + Intronic
939413545 2:141862856-141862878 AATAGTCTTCAGGGCAAAGTTGG + Intronic
939547630 2:143572495-143572517 TTTGTTCATCTGAGCACAGTAGG + Intronic
940588769 2:155692234-155692256 TATATCCTCCAGTGAACAGTTGG - Intergenic
941374853 2:164714928-164714950 TATATTATTCAAAGAGCAGTAGG - Intronic
942143307 2:173000023-173000045 TATATTCTTGAGAACAGAGTAGG - Intronic
943978325 2:194511964-194511986 TATATTCCTCAGAGAACTGCAGG - Intergenic
944086177 2:195850451-195850473 TATATTCATAATAGCACTGTAGG + Intronic
946985306 2:225265484-225265506 TCTAGTCTTTGGAGCACAGTAGG + Intergenic
1173398580 20:42703827-42703849 TCTATTTCTTAGAGCACAGTAGG - Intronic
1173897515 20:46562220-46562242 TATCTTATTCAAACCACAGTGGG - Intronic
1177472182 21:21573246-21573268 AATATTCTTTAGGGCATAGTTGG - Intergenic
1177688920 21:24477713-24477735 TATACTCATCAGATCAAAGTTGG + Intergenic
1178267185 21:31154421-31154443 TGTACTCTTCGGAGCACAGGGGG + Exonic
1180646360 22:17342355-17342377 TGTATTGTTCAGAGGAGAGTAGG + Intergenic
1184100462 22:42339389-42339411 AACATTCTGCAGGGCACAGTGGG + Intronic
949210849 3:1499237-1499259 TTGATTTTTCAGAGCACAGATGG - Intergenic
949911738 3:8915891-8915913 TATTTTCTACAGACCTCAGTGGG + Intronic
950979136 3:17283084-17283106 CAAATTCTTCAAAGCCCAGTTGG + Intronic
952149886 3:30577964-30577986 TATGTTCTTCTAACCACAGTGGG - Intergenic
955852210 3:63232649-63232671 TCTACACTTCACAGCACAGTTGG - Intronic
957329801 3:78747106-78747128 GATATTCTTCAGAGGCCAGCAGG + Intronic
957377618 3:79378998-79379020 TAGTGTCTTCAGAGCACAGAGGG - Intronic
958982923 3:100745520-100745542 TATAATCTTCAGTGGACAGATGG - Intronic
959166100 3:102780167-102780189 GGTCTTTTTCAGAGCACAGTAGG - Intergenic
959856863 3:111169389-111169411 TTTTTTTTTAAGAGCACAGTTGG + Intronic
960191136 3:114707509-114707531 TATTTTCTTGTGAGCACAATGGG - Intronic
963652627 3:148001924-148001946 TATTTTATTTACAGCACAGTGGG + Intergenic
963964551 3:151351339-151351361 GATAGTCCTCAGAACACAGTGGG + Intronic
964132083 3:153300847-153300869 TATGTTCTGCAGAACACATTTGG + Intergenic
965387591 3:168063500-168063522 TGTATTCTTCATAGCACATCAGG - Intronic
965714618 3:171589412-171589434 TTTATTCATCAGGGCACACTAGG - Intergenic
970114320 4:12676777-12676799 TATATTCTTAGGGGCAGAGTAGG + Intergenic
972652671 4:41034209-41034231 GATGTTCTTCAGTGCACAGCTGG + Intronic
973228559 4:47815440-47815462 TATTTTCTTCAGAGCACTGTAGG + Intronic
974034947 4:56809835-56809857 TATTTTCAACAGAGAACAGTAGG + Intergenic
974667266 4:64980008-64980030 TATATGACTCACAGCACAGTAGG - Intergenic
975925753 4:79450315-79450337 TAATGTATTCAGAGCACAGTTGG + Intergenic
976218811 4:82739602-82739624 TAGATACTTCAGAGCATCGTTGG - Intronic
976567264 4:86565270-86565292 TTTATTCTTTTGAGCAAAGTAGG - Intronic
978710521 4:111775079-111775101 TATATCCATGAGAACACAGTGGG - Intergenic
980325776 4:131343358-131343380 AATCTTCTTCTGAGCACTGTTGG - Intergenic
980763527 4:137267970-137267992 TATATTTTTCAGCTCCCAGTGGG + Intergenic
981479985 4:145228616-145228638 TGCTCTCTTCAGAGCACAGTTGG + Intergenic
981876828 4:149557040-149557062 AATATTTTTCAGAGTACACTGGG - Intergenic
982043761 4:151421147-151421169 TATATTCTGTATAGCACATTTGG + Intronic
982092079 4:151888909-151888931 TATATGCCTCAGAGTACTGTAGG + Intergenic
982201360 4:152964241-152964263 TATATTCTTCAGAAGACAAAGGG + Intronic
983911482 4:173244340-173244362 TGTATTCTCCAGAGGGCAGTGGG + Intronic
987685833 5:21199779-21199801 TCTAGTGTTCATAGCACAGTAGG - Intergenic
988421627 5:31012704-31012726 TTAATTCCTGAGAGCACAGTGGG + Intergenic
988717806 5:33844975-33844997 TAAAATTTTCAGACCACAGTCGG + Intronic
989337396 5:40334670-40334692 TATATTCCTGGCAGCACAGTAGG + Intergenic
990185601 5:53206280-53206302 TCTGTTCTTCATAGCAGAGTAGG + Intergenic
993637945 5:90368550-90368572 TATATGCTTCAGATAGCAGTTGG - Intergenic
994149256 5:96429835-96429857 TATATTCATTAGCTCACAGTAGG + Intronic
996766116 5:127035649-127035671 TTTATTCTTCACAGCACACCTGG + Intergenic
999808404 5:155105450-155105472 AATTTTCTTAAGAGCTCAGTTGG - Intergenic
1000393967 5:160753538-160753560 AATATTCTTCAGATCACAGTAGG - Intronic
1001105713 5:168852370-168852392 TTTAATCTTTAGAGCCCAGTGGG - Intronic
1001126951 5:169028266-169028288 TATGTACTTCAGAGCTCAGGGGG + Intronic
1002615267 5:180449508-180449530 TATATACTTTAGAACACAGCTGG + Intergenic
1003163813 6:3658820-3658842 TAAATTCTTCAGACCTCAGCAGG - Intergenic
1003753429 6:9088642-9088664 TATATTCTGCAGAGGTCAATGGG + Intergenic
1008123202 6:47641151-47641173 TATTCTCTTCAAAGCTCAGTTGG + Intergenic
1010892988 6:81337132-81337154 TCTGTTCCTGAGAGCACAGTGGG + Intergenic
1010894998 6:81351282-81351304 TCTGTTCCTGAGAGCACAGTGGG + Intergenic
1012172881 6:96041331-96041353 TGTATTCTACCAAGCACAGTAGG - Intronic
1012560654 6:100577041-100577063 TTTATTCTTCAGAGTATTGTGGG - Intronic
1013902025 6:115168062-115168084 AATATTCTTCACTGCTCAGTTGG + Intergenic
1015097412 6:129432165-129432187 TTTGTTCTCCAGACCACAGTAGG - Intronic
1016664594 6:146621624-146621646 TAAATTCACCAGAGCACAGAGGG - Intronic
1020927085 7:14342963-14342985 TATATTTTTCAAACCATAGTAGG + Intronic
1022185182 7:27960513-27960535 TATATTCTTCAGTGCACAACAGG + Intronic
1023295768 7:38713756-38713778 TATATTCTGCAGAGATCATTCGG - Intergenic
1025807085 7:64844342-64844364 TCTATTCTTCTGGGCACTGTAGG - Intergenic
1027366336 7:77462289-77462311 TGGTTTCTGCAGAGCACAGTTGG + Intergenic
1027447242 7:78288578-78288600 TACACTCTTCAAAGCTCAGTTGG - Intronic
1029661051 7:101962110-101962132 TATATTTTTCTGATCACAGAAGG - Intronic
1030308070 7:108039231-108039253 TACACTGTTCAGAGAACAGTGGG + Intronic
1030444466 7:109632021-109632043 TTTTTACTTCAGAGAACAGTGGG + Intergenic
1031594164 7:123628557-123628579 TATATTGTTCAGAGGAGAATTGG + Intronic
1031947497 7:127857525-127857547 TTTTTTCTTCGTAGCACAGTTGG + Intronic
1033800060 7:144890527-144890549 TATATTCTTGAGTGAGCAGTAGG + Intergenic
1035987680 8:4452995-4453017 TGTATTCTTCAGAGGACTGTGGG - Intronic
1036271496 8:7308322-7308344 TATATTCCTCAGAGCTGAGGAGG - Intergenic
1036349852 8:8002027-8002049 TATATTCCTCAGAGCTGAGGAGG + Intergenic
1036813009 8:11880440-11880462 TATATTCTTCACAAAACAGAGGG + Intergenic
1037464991 8:19151260-19151282 TATATTGTTCATAGCAAGGTAGG - Intergenic
1038200504 8:25408571-25408593 TTGATTCTTCTGATCACAGTTGG - Intronic
1038372127 8:27004855-27004877 CATATTCTTCACAGATCAGTTGG + Intergenic
1038434521 8:27525843-27525865 CAGATTCTTCAGAGCACATGTGG - Intronic
1038979751 8:32746639-32746661 TATATTGCTCAGAGCACAGCAGG + Intronic
1039105454 8:33984636-33984658 GTTATTTTTCAGAGCACTGTAGG + Intergenic
1046019993 8:108653293-108653315 TATATTCTTCAGAGCACAGTGGG + Intronic
1046255100 8:111686316-111686338 TACATTCTTCACAGAACAATTGG + Intergenic
1052286400 9:26790695-26790717 AATGTTCTTCAGAGTAGAGTTGG - Intergenic
1058031588 9:100204478-100204500 GATATTGTTCAGAGCACTCTGGG + Intronic
1059613223 9:115921653-115921675 TCATTTCTTTAGAGCACAGTTGG + Intergenic
1060413981 9:123418047-123418069 GATTTTCTTCTGAGCTCAGTGGG + Intronic
1188639896 X:32488064-32488086 TTTGTTTTTCAGAGCACACTTGG - Intronic
1188851776 X:35141082-35141104 TATAATTTTCAGAAAACAGTAGG - Intergenic
1196847485 X:119907800-119907822 TATATTCTTTCCACCACAGTAGG + Intronic
1198177850 X:134173203-134173225 TTTATTCTACAGAGCGCTGTCGG - Intergenic