ID: 1046021189

View in Genome Browser
Species Human (GRCh38)
Location 8:108667114-108667136
Sequence ATGTGCTTTTCGAAGTGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046021186_1046021189 21 Left 1046021186 8:108667070-108667092 CCCAACATAGATTGATTTGTGTG 0: 1
1: 0
2: 1
3: 17
4: 158
Right 1046021189 8:108667114-108667136 ATGTGCTTTTCGAAGTGGCCAGG No data
1046021187_1046021189 20 Left 1046021187 8:108667071-108667093 CCAACATAGATTGATTTGTGTGT 0: 1
1: 0
2: 1
3: 18
4: 237
Right 1046021189 8:108667114-108667136 ATGTGCTTTTCGAAGTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046021189 Original CRISPR ATGTGCTTTTCGAAGTGGCC AGG Intronic
No off target data available for this crispr